CUSTOM PRESCOTT'S MICROBIOLOGY
11th Edition
ISBN: 9781266032844
Author: WILLEY
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 3.6, Problem 3CC
Retrieve, Infer, Apply
do plasmids differ from chromosomes? What is an episome?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Elucidate two physical properties that will enable you to isolate TOL plasmid from the chromosomal DNA of the bacteria.
explain the method of Identifying mutant genes by plasmid librarytransformation
AGAROSE GEL ELECTROPHORESIS PRELAB
ANSWER ALL QUESTIONS
1. Type of nucleotide is one of the factors that influence electrophoretic mobility.
a) True
b) False
2. Electrophoresis is used for DNA separation and not proteins.
a) True
b) False
3. DNA Polymerase is an enzyme to cut DNA into fragments for electrophoresis.
a)True
b)False
4. Electrophoresis apparatus consists of Gel buffer, chamber and DNA separator.
a) True
b) False
5. During electrophoresis, DNA fragments collect at the Cathode.
a) True
b) False
Chapter 3 Solutions
CUSTOM PRESCOTT'S MICROBIOLOGY
Ch. 3.2 - Retrieve, Infer, Apply Why is the term prokaryote...Ch. 3.2 - Retrieve, Infer, Apply What characteristic shapes...Ch. 3.2 - Retrieve, Infer, Apply What advantages might a...Ch. 3.2 - Prob. 4CCCh. 3.3 - Retrieve, Infer, Apply List the functions of...Ch. 3.3 - Prob. 2CCCh. 3.3 - Retrieve, Infer, Apply 3. On what basis are...Ch. 3.3 - Retrieve, Infer, Apply Describe facilitated...Ch. 3.3 - Retrieve, Infer, Apply 5. What are uniport,...Ch. 3.3 - Retrieve, Infer, Apply 6. What are siderophores?...
Ch. 3.4 - MICRO INQUIRY How does the outer membrane of the...Ch. 3.4 - MICRO INQUIRY Are these transporter proteins...Ch. 3.4 - Retrieve, Infer, Apply Describe in detail the...Ch. 3.4 - Retrieve, Infer, Apply When protoplasts and...Ch. 3.4 - Retrieve, Infer, Apply 4. The cell walls of most...Ch. 3.4 - Retrieve, Infer, Apply What two mechanisms allow...Ch. 3.5 - Retrieve, Infer, Apply What is the difference...Ch. 3.5 - Retrieve, Infer, Apply S-layers and some capsules...Ch. 3.6 - Retrieve, Infer, Apply Briefly describe the nature...Ch. 3.6 - Retrieve, Infer, Apply List the most common kinds...Ch. 3.6 - Retrieve, Infer, Apply do plasmids differ from...Ch. 3.6 - Prob. 4CCCh. 3.7 - MICRO INQUIRY How does flagellum growth compare to...Ch. 3.7 - Retrieve, Infer, Apply What are the functions of...Ch. 3.7 - Retrieve, Infer, Apply What terms are used to...Ch. 3.7 - Retrieve, Infer, Apply What is self-assembly? Why...Ch. 3.8 - Would this flagellum be found in a typical...Ch. 3.8 - Retrieve, Infer, Apply Describe the way many...Ch. 3.8 - Prob. 2CCCh. 3.8 - Prob. 3CCCh. 3.8 - Retrieve, Infer, Apply Suggest why chemotaxis is...Ch. 3.9 - Retrieve, Infer, Apply Describe the structure of...Ch. 3.9 - Retrieve, Infer, Apply Briefly describe endospore...Ch. 3.9 - Retrieve, Infer, Apply What features of the...Ch. 3 - Prob. 1RCCh. 3 - Prob. 2RCCh. 3 - Prob. 3RCCh. 3 - Propose a model for the assembly of a flagellum in...Ch. 3 - The peptidoglycan of bacteria has been compared...Ch. 3 - Why might a microbe have more than one uptake...Ch. 3 - Prob. 4ALCh. 3 - What would you expect to observe if you were able...Ch. 3 - Develop a hypothesis to explain why gas vacuoles...Ch. 3 - Prob. 7AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Expand PCR? Describe the different Steps involved in this technique?arrow_forwardWhat makes platinum replica EM more desirable than conventional SEM and TEM (address both, specifically) for imaging cytoskeleton?arrow_forwardDefine triturate. Define supernatant. Why is SYBR green dye added to the gel? What is the centrifuge used for? What are restriction enzymes used for? What is a plasmid?arrow_forward
- after transformming E. coli by inserting a plasmid what new characteristic is acquired ?arrow_forwardDescribe unique characteristics of agarose used in electrophoresis.arrow_forwardWhat is the purpose of arabinose in the pGLO lab, where is arabinose located, how can it be described as differential, and how does it relate to the plasmid used?arrow_forward
- Bacterial Identification Virtual Lab Add the Master Mix and answer the following questions: 13. What does the Master Mix contain? 14. What are primers? Why is a primer added? 15. Once the primers bind, what occurs next? 16. What does "highly conserved" mean? 17. Why are highly conserved regions important in this lab?arrow_forwardpls do not copy paste Explain the steps of preparing a cell culture stock from a T25 flask.arrow_forward"Hybridization of a single-stranded DNA molecule attached to a fluorophore with a preparation of metaphase chromosomes that have been partially denatured" is a description of which laboratory method?arrow_forward
- Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for delivering into human cells.arrow_forwardGive typed full explanation Antibiotic sensitivity.What is relationship to ellipse size and sensitivity for an E-Test?arrow_forwardExplain The replica plating technique?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License