
Introduction:
The process of digestion refers to the catabolism of the food. There are various enzymes and secretions produced by the GI tract that helps in the solubilization of the food material and helps in the absorption by the body.

Answer to Problem 1SQ
Correct answer:
A
Explanation of Solution
Reason for correct answer:
Option d. is given as “all of the above.”
The process of digestion starts with the process of enzymes secretion. It helps in the solubilization of food. The absorption of the nutrients takes place in the intestine. The intestine is composed of finger-like projections that are referred to as villi. Each of these villi consists of a capillary network in which food gets absorbed. After the absorption process, it goes to the liver for the elimination of wastes.
Reason for incorrect answer:
Option a. is given as, “secreting enzymes.”
This process only secretes enzymes to the food for its digestion, also there are other processes involved in the process of digestion. Hence, option a. is incorrect.
Option b. is given as, “absorbing compounds.”
This process cannot take place before the secretion of enzymes for digesting food. There are other processes involved in the process of digestion. Hence, option b. is incorrect.
Option c. is given as, “eliminating wastes.”
The process of waste elimination occurs after the process of enzyme secretion and food absorption. Hence, option c. is incorrect.
Hence, the options a, b, and c are incorrect.
A digestive system functions in eliminating wastes, absorbing compounds, and secreting enzymes. Thus, the correct option is d.
Want to see more full solutions like this?
Chapter 36 Solutions
EBK BIOLOGY: CONCEPTS AND APPLICATIONS
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning


