<LCPO> BIOLOGY
12th Edition
ISBN: 9781266216398
Author: Raven
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Question
Chapter 34.4, Problem 1LO
Summary Introduction
To distinguish: The vertebrates from other chordates.
Introduction: Chordata is divided into Urochordata, Cephalochordata, and Vertebrata. The chordates have several characteristics such as the presence of a notochord, nerve cord, pharyngeal slits, and a post-anal tail.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 34 Solutions
<LCPO> BIOLOGY
Ch. 34.1 - List the specific characteristics of echinoderms.Ch. 34.1 - Explain what is meant by pentaradial symmetry.Ch. 34.1 - Describe the five extant classes of echinoderms.Ch. 34.2 - List the defining characteristics of chordates.Ch. 34.2 - Prob. 2LOCh. 34.3 - Describe the nonvertebrate chordates and their...Ch. 34.4 - Prob. 1LOCh. 34.4 - Prob. 2LOCh. 34.5 - Prob. 1LOCh. 34.5 - Prob. 2LO
Ch. 34.6 - Prob. 1LOCh. 34.6 - Prob. 2LOCh. 34.7 - Prob. 1LOCh. 34.7 - Prob. 2LOCh. 34.7 - Prob. 3LOCh. 34.8 - Prob. 1LOCh. 34.8 - Prob. 2LOCh. 34.9 - Prob. 1LOCh. 34.9 - Prob. 2LOCh. 34.10 - Describe the characteristics and major groups of...Ch. 34.10 - Prob. 2LOCh. 34.10 - Prob. 3LOCh. 34 - Prob. 1IQCh. 34 - Prob. 2IQCh. 34 - Which of the following structures is not a...Ch. 34 - Which of the following statements regarding all...Ch. 34 - In the figure, item A is the ______ and item B is...Ch. 34 - Prob. 4UCh. 34 - The ____ of the bony fish evolved to counter the...Ch. 34 - Why was the evolution of the pulmonary veins...Ch. 34 - Which of the following groups lacks a...Ch. 34 - All of the following are characteristics of...Ch. 34 - Which of the following evolutionary adaptations...Ch. 34 - The reason that birds and crocodilians both build...Ch. 34 - Prob. 2ACh. 34 - The fact that monotremes lay eggs a. indicates...Ch. 34 - Prob. 1SCh. 34 - Some people state that the dinosaurs have not gone...Ch. 34 - In what respect is the evolutionary...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning


Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
The Skeletal System; Author: Professor Dave Explains;https://www.youtube.com/watch?v=f-FF7Qigd3U;License: Standard YouTube License, CC-BY