BROOKER BIOLOGY
5th Edition
ISBN: 9781307656152
Author: BROOKER
Publisher: MCG/CREATE
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 33, Problem 9TY
Summary Introduction
Introduction: An embryo subdivides into multiple segments due to the presence of segmentation genes. Hox genes then cause each segment to develop its own unique characteristics. The evolution of body forms and novel structures in arthropods and vertebrates have occurred due to the shift in the expression patterns of Hox genes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Which of the following statements about genes is incorrect?
Select one:
O a. During fertilization, both the sperm and the ovum contribute genes to the resulting fertilized egg.
b. Genetic differences can result from changes in the DNA called mutations.
O c. Genes correspond to segments of DNA.
d. Under normal circumstances, each chromosome contains precisely one gene.
e. Many genes contain the information needed for cells to synthesize enzymes and other proteins.
Which of the following statements about Tbx5 is true?
a. Tbx5, Tbx4, and AmphiTbx4/5 have very similar coding regions.
b. Tbx5 is involved in tail development in vertebrates.
c. Tbx5, Tbx4, and AmphiTbx4/5 have very similar regulatory regions.
d. Tbx5 initiates hindlimb development.
The process of gene expression involves:
Chapter 33 Solutions
BROOKER BIOLOGY
Ch. 33.2 - Core Skill: Connections Look back to Figure 25.8....Ch. 33.2 - Prob. 2CSCh. 33.3 - Prob. 1CSCh. 33.3 - Prob. 1EQCh. 33.3 - Prob. 2EQCh. 33.3 - Prob. 3EQCh. 33 - Prob. 1TYCh. 33 - Prob. 2TYCh. 33 - Prob. 3TYCh. 33 - In triploblastic animals, the inner lining of the...
Ch. 33 - Prob. 5TYCh. 33 - Prob. 6TYCh. 33 - Prob. 7TYCh. 33 - Naturally occurring identical twins are possible...Ch. 33 - Prob. 9TYCh. 33 - A major finding of recent molecular studies is...Ch. 33 - Fierce debate centers on whether ctenophores or...Ch. 33 - Why was the evolution of a coelom important?Ch. 33 - Prob. 3CQCh. 33 - Discuss the many ways that animals can affect...Ch. 33 - Prob. 2COQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- An organism has a relatively large number of Hox genes in its genome. Which of the following is true of this organism? Select one: А. Its Hox genes cooperate to bring about sexual maturity at the proper stage of development. В. Most of its Hox genes owe their existence to gene fusion events. С. The organism must have multiple paired appendages along the length of its body. D. These genes are fundamental, and are expressed in all cells of the organism. E. The organism has the genetic potential to have a relatively complex anatomy.arrow_forwardWhen using gene therapy to treat an hereditary disease, the idea is to: A. Introduce the correct gene into the patient's DNA B. Inject the patient with a specific protein to cure the disease. C. Blood transfusions from healthy individuals. D. ntroduce mRNA molecules with the correct genetic information to the patient. E. Introduce a virus to the patient that will specifically destroy mutated cells.arrow_forward1a) Why is it possible for you to study the eye colour gene by extracting cheek cells? a. Because the nucleus of every cell in the human body contains the same genetic information. b. Because the cheek cells are located near the cells of the eye and so they are able to exchange DNA. c. Because all genes in the human body are expressed at all times so it is easy to study them. d. All of the above are possible explanations. 1b) What is the purpose of heating the sample to 75°C following addition of the 0.2M NaOH solution? a. To denature the histone proteins that are keeping the DNA tightly coiled. b. To ensure that all the DNA is removed from the swab in preparation for PCR. c. To breakdown the cheek cell membrane to release the DNA from the cell. d. It breaks down the circular DNA down into linear fragments so that they will be easier to visualize.iarrow_forward
- If a mutation in a homeotic gene produced the following phenotypes, would you expect it to be a loss-of-function or a gain-offunction mutation? Explain your answer. A. An abdominal segment has antennae attached to it. B. The most anterior abdominal segment resembles the most posterior thoracic segment. C. The most anterior thoracic segment resembles the most posterior abdominal segment.arrow_forwardGene expression is a term that relates to Select one: A. DNA replication. B. the flow of genetic information from DNA to proteins. C. how genes are passed from parent to offspring. D. the unique set of genes in an individual.arrow_forwardWhich of the following is the sequence in which the segmentation genes act? a. Segment-polarity genes → gap genes → pair-rule genes b. Gap genes → pair-rule genes → segment-polarity genes c. Segment-polarity genes → pair-rule genes → gap genes d. Gap genes → segment-polarity genes → pair-rule genesarrow_forward
- Epigenesis relating to genetics refers to which of the following A. Genetic information is limited to what we inherit only from our biological parents. B. Genes are not influenced by environmental factors. C. Genes we inherit are fully expressed at birth. D. Genes are turned on or off as needed, by the developing body or environmental triggers, across the life-spanarrow_forwardInsect wings are coded for by the same gene that creates... A. internal air branches (trachea) B. Their cuticle C. their antennae D. parts of crustacean appendages, like legsarrow_forwardA.) DNA encodes for the cell genome and is therefore a permanent copy to have a functioning cell. B.)Different changes to the structure of messenger RNA can cause mutations and genomic instability which could lead to abnormal cells in the body. a. Statement A is correct b. Statement B is correct c. Both A and B are correct d. Both A and B are incorrectarrow_forward
- Of those in the following list, which organ(s)/tissue(s) is/are affected by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? select all that apply a. pancreas b. skin c. heart d. eyes e. spine and skeleton f. colonarrow_forwardWhich of the following is true about the enzyme telomerase? A. It is found only in adult cells. B. It is responsible for telomere shortening. C. It can re-establish telomere length. D. It may speed up the aging process. E. It is expressed at low levels in cancer cells.arrow_forwardDNA methylation is A. heritable and generally activates gene expression. B. heritable and generally represses gene expression. C. not heritable and generally represses gene expression. D. not heritable and generally activates gene expression.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY