
Concept explainers
Introduction:
Mitochondria are cell organelles that generate chemical energy required to power the cell's biochemical reactions. The chemical energy produced by the mitochondria is stored in a small molecule called adenosine triphosphate (ATP).

Answer to Problem 2STP
Correct answer:
The correct answer is option (a) at number 1 there is Mitochondria.
Explanation of Solution
Explanation/justification for the correct answer:
Option (a) during everyday activities and light exercise, the mitochondria of muscle fibers produce ATP in a process called aerobic respiration. Aerobic respiration requires the presence of oxygen to break down food energy (usually glucose and fat) to generate ATP for muscle contractions.
The main organelle involved in respiration is the mitochondria. It's known as the powerhouse of the cell because 32 ATP is created from this organelle
Explanation for incorrect answer:
Option (b) at number 2 there is cytosomes. They are proteins that contain heme as their prosthetic group. Their principal function is the electron transport. They are firmly integrated in the inner membrane of the mitochondria.
Option (c) at number 3 there is lysosomes that regulate immune response by modulating cellular
Option (d) at number 4 there are cell membranes that divide the interior of all cells from the outside environment and protects them.
The energy synthesized during
Chapter 32 Solutions
Biology Illinois Edition (Glencoe Science)
Additional Science Textbook Solutions
Chemistry
Anatomy & Physiology (6th Edition)
Human Physiology: An Integrated Approach (8th Edition)
Genetic Analysis: An Integrated Approach (3rd Edition)
Brock Biology of Microorganisms (15th Edition)
Chemistry: The Central Science (14th Edition)
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





