
Concept explainers
Introduction:

Answer to Problem 1U
Correct answer:
Ability to conduct photosynthesis is not a characteristic of a fungus. Therefore, option c. is correct.
Explanation of Solution
Reason for the correct statement:
Fungi lack chloroplasts and hence they cannot conduct photosynthesis. They are heterotrophs that obtain food from their surroundings by secreting digestive enzymes and then absorbing the organic molecules produced as a result of external digestion.
Option c. is given as “ability to conduct photosynthesis”.
As, “Fungus cannot conduct photosynthesis”, is the right answer.
Hence, option c. is correct.
Reason for the incorrect statements:
Option a. is given as “Cell wall made of chitin”.
Fungus has cell wall made up of polysaccharide called chitin, so, it is a wrong answer.
Option b. is given as “A form of mitosis different from plants and animals”.
Fungus undergoes a different form of mitosis in which the nuclear envelope does not breakdown and reform, and the spindle apparatus is formed within the nucleus, so, it is a wrong answer.
Option d. is given as “Filamentous structure”.
Fungus may be either unicellular or filamentous structure, so, it is a wrong answer.
Hence, options a, b, and d are incorrect.
Fungus is heterotroph that obtains food from their surroundings by external digestion.
Want to see more full solutions like this?
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning





