Prescott's Microbiology
10th Edition
ISBN: 9781259281594
Author: Joanne Willey, Linda Sherwood Adjunt Professor Lecturer, Christopher J. Woolverton Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 31.1, Problem 1MI
How are filamentous microbes especially well suited to the soil ecosystem?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 31 Solutions
Prescott's Microbiology
Ch. 31.1 - How are filamentous microbes especially well...Ch. 31.1 - Prob. 1RIACh. 31.1 - Prob. 2RIACh. 31.1 - Prob. 3RIACh. 31.1 - What microbes commonly degrade cellulose and...Ch. 31.1 - Which of the following soils would a farmer be...Ch. 31.1 - Why is most nitrogen fertilizer added as ammonium...Ch. 31.2 - What are the differences in preferred soil...Ch. 31.2 - What types of archaea have been detected in soils?Ch. 31.2 - Prob. 3RIA
Ch. 31.3 - Which hyphae are growing saprotrophically in this...Ch. 31.3 - How do you think Frankia spp. protect nitrogenase...Ch. 31.3 - How does the production of opines by the plant...Ch. 31.3 - Define rhizosphere, rhizoplane, and associative...Ch. 31.3 - What unique stresses does a microorganism on a...Ch. 31.3 - List two ways in which compounds produced by...Ch. 31.3 - What important genera are involved in associative...Ch. 31.3 - Prob. 2.1RIACh. 31.3 - Prob. 2.2RIACh. 31.3 - What is the function of the rhizomorph and the...Ch. 31.3 - Describe the uptake and transfer of ammonium by...Ch. 31.3 - Propose two potential functions for mycorrhization...Ch. 31.3 - List several bacteria that are considered...Ch. 31.3 - Prob. 3.2RIACh. 31.3 - What does the term terminally differentiated mean?Ch. 31.3 - How does nitrogen transfer between a rhizobium and...Ch. 31.3 - What is unusual about leghemoglobin production and...Ch. 31.3 - What are the two general mechanisms by which...Ch. 31.3 - What is the difference between the Ti plasmid and...Ch. 31.3 - What functions do the members of the two-component...Ch. 31.3 - What are the two general ways by which plant...Ch. 31.3 - How are plant pathologists attempting to control...Ch. 31.4 - Compare and contrast the metabolism (specifically,...Ch. 31.4 - What happens in terms of microbiological processes...Ch. 31.4 - What microbial genera have been observed in oil...Ch. 31 - Why might vascular plants have developed...Ch. 31 - Prob. 2CHICh. 31 - Prob. 3CHICh. 31 - Prob. 4CHICh. 31 - Prob. 5CHICh. 31 - Prob. 6CHI
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
How do Plants Handle Stress?; Author: Alex Dainis;https://www.youtube.com/watch?v=TYsnveEHqec;License: Standard Youtube License