Concept explainers
Interpretation:
Whether one can reach an unambiguous conclusion from the given data should be determined.
Concept Introduction:
The molecule which provides cells and whole organisms their shape and the ability to reproduce, develop and move are known as proteins. The procedure to find out the order of protein of amino acids is known as protein sequencing. The sequence of a protein can simply be deduced from its sequence of gene, because the order of the bases on the DNA stand stipulates the order within with amino acid are associated together in translation.
Answer to Problem 1P
No, we cannot reach an unambiguous conclusion.
Explanation of Solution
Given:
Partial amino acid sequence of the protein:
…CAATACGAAGCAATCCCGCGACTAGACCTTAAC…
To create any conclusion regarding the cDNA strand we should initially examine the sequence. After changing to its RNA form, we get the below strand.
CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC
Initial thing is to find out the reading frame by looking for the initial codon AUG. There is no start CODON in the sequence.
Now, we look for the stop codons: UGA, UAG or UAA.
CAAUACGAAGCAAUCCCGCGACUAGACCUUAAC
We now could see that there are stop codons for 2 of the 3 probable reading frames. It actually means that preceding codons account for the protein’s C-terminal. The third reading frame could start with CAA and would not have the stop codon in the protein of the DNA sequence which we are given.
More information is required to find out which is the correct reading frame.
Want to see more full solutions like this?
Chapter 30 Solutions
BIOCHEMISTRY II >CUSTOM<
- Do schwann cells produce or act as myelin in the peripheral nervous system? I know that they encase and wrap around axons, but where does the myelin come into play?arrow_forwardThe enzyme lactate dehydrogenase (LDH) catalyzes the conversion of pyruvate to lactatein skeletal muscle cells using NAD/NADH during anaerobic “balanced” fermentation.Answer the following questions about this reaction. (a) Write out the two reductive half reactions and indicate the E ̊' for each half reaction. Write out the full balanced reaction for the pyruvate to lactate rxn and indicate the ∆E ̊' for the reaction. (b) What is the free energy change under standard state conditions for thisreaction? Which direction is spontaneous?(c) Assume that in skeletal muscle cells the ratio of [NAD+] to [NADH] is 100, and that the[pyruvate] = 0.40 mM and [lactate] = 4.0 mM. What is the free energy change (∆G')for the conversion of pyruvate to lactate? Indicate the direction in which the reactionis spontaneous under these cellular conditions.arrow_forwardWhy did the authors worry about the temperature-dependent solubility of the carriers in thebilayer? How did the authors determine whether the effect of freezing the lipid bilayer wasto decrease the solubility of the carriers (nonactin and valinomycin) or whether the effectwas to impair their ability to diffuse through the membrane (decrease their mobility)?arrow_forward
- Kranse et. al. measured the temperature dependence of conductance using membranescontaining the phospholipids glyceryl dipalmitate and glyceryl distearate. Describe themodifications in membrane content that you would employ to: (a) shift the temperature of the phase transition (b) make the ion conductance curve for valinomycin andnonactin more like that of gramicidinarrow_forwardObtain the sequence for the 5-HT receptor HTR1A and generate a hydropathy plot usingthe ExPASY tool ProtScale, the appropriate window, and the Kyte-Doolittle weightingalgorithm. How many transmembrane domains are present in this receptor? Attach yourhydropathy plot to your assignment.arrow_forwardCompare and contrast the structural features of the ion carrier valinomycin with those of achannel former like gramicidin. How does structural information help explain the mechanismby which these molecules conduct ions across membranes?arrow_forward
- A typical integral membrane protein has a stretch (or stretches) of ~20 hydrophobic aminoacids that form an α-helix that spans the bilayer (as is found in membrane proteins such asglycophorin A and bacteriorhodopsin). Compare and contrast the molecular and structural features of gramicidin with a membrane-spanning α-helix. Explain how gramicidin can forman ion channel when a typical membrane-spanning α-helix cannot (eg, glycophorin A).arrow_forwardThe titration curve of alanine shows the ionization of two functional groups with pK values of 2.34 and 9.69, corresponding to the ionization of the carboxyl and the protonated amino groups, respectively. The titration of di-, tri-, and larger oligopeptides of alanine also shows the ionization of only two functional groups, although the experimental pK values are different. The table summarizes the trend in pK values. Amino acid or peptide Ala Ala-Ala pKj pk₂ 2.34 9.69 3.12 8.30 Ala-Ala-Ala 3.39 8.03 Ala-(Ala)-Ala, n ≥ 4 3.42 7.94 Modify the molecules to show the oligopeptide Ala-Ala-Ala. You can modify the molecules by moving, adding, deleting, or changing atoms, bonds, or charges. C Select c Draw Templates More H с N 0 S Cl H H | | || H CH3 H CH, H CH₂ Complete the statements about the the pK, values of the Ala-Ala-Ala oligopeptide. The pK₁ value of 3.39 is associated with the -COO group of Ala-Ala-Ala. The pK2 value of 8.03 is associated with the -NH group of Ala-Ala-Ala. Erase Q2 Q…arrow_forwardFacts from the bacterium mals and to dept kan apa in a peptide with antidic properties. This peptide complex with the call membrance of other hacterial species, leading in bacterial death The structure of the peptide has been determined from (a) Cmplete acid hydes of the peptide, followed by amino acid analys, yielded quiar anunt of Lan, Om, Pfx, Prxa, and Wall Cmtiti, an amino acid od prosentin pockets but present in some peptides. Com has the tracture H *H,N-CH-CH-CH, -C- COO (b) The weight of the peptide in approximately 1,200 Th (c) The peptide failed to undergo hydrolysis when treated with the Hydrolysis of the carbonyl-terminal residue of a polypeptide une "NH, the year. This call there Pro or the police does not contain a froz (d) Treatment of the peptide with 1-haw-2,4-dicherer (11N1), followed by complete hydrolysis and ched only from and the derivative NO, Н ON NHCHI CH, CH, C coo +NH, (Hint: The 2,4-diphenyl derivative involves the amino group of a side chain rather than the…arrow_forward
- Electrophoresis Macmillan Learning Chymotrypsin is a protease with a molecular mass of 25.6 kDa. The figure shows a stained SDS polyacrylamide gel with a single band in lane I and three bands of lower molecular weight in lane 2. Lane I contains a preparation of chymotrypsin and lane 2 contains chymotrypsin pre-treated with performic acid. 1 2 Why does performic acid treatment of chymotrypsin generate three bands in lane 2? ° Chymotrypsin self-digests on the carboxyl-terminal side of phenylalanine, tryptophan, or tyrosine residues. The three peptides are impurities in the original chymotrypsin sample. Performic acid cleaves proteins on the carboxyl-terminal side of lysine and arginine residues. Performic acid cleaves the disulfide bonds holding together the three subunits of chymotrypsin. Correct Answerarrow_forwardExtracts from the bacterium Bacillus brevis contain a peptide with antibiotic properties. This peptide forms complexes with metal ions and seems to disrupt ion transport across the cell membranes of other bacterial species, leading to bacterial death. The structure of the peptide has been determined from a series of observations. (a) Complete acid hydrolysis of the peptide, followed by amino acid analysis, yielded equimolar amounts of Leu, Orn, Phe, Pro, and Val. Orn is ornithine, an amino acid not present in proteins but present in some peptides. Orn has the structure H 'H,N-CH, - CH2 CH2 CH2 - C - COO- NH, (b) The molecular weight of the peptide is approximately 1,200 Da. (c) The peptide failed to undergo hydrolysis when treated with the enzyme carboxypeptidase. This enzyme catalyzes the hydrolysis of the carboxyl-terminal residue of a polypeptide unless the residue is Pro or the peptide does not contain a free carboxyl group. (d) Treatment of the intact peptide with…arrow_forwardAt a pH equal to the isoelectric point (pl) of alanine, the net charge of alanine is zero. Two structures can be drawn that have a net charge of zero, but the predominant form of alanine at its pl is zwitterionic. CH3 H,N CH3 ** H¸N-C H Zwitterionic H Uncharged OH Select statements that explain why alanine is predominantly zwitterionic at its pl. pk of alanine's amino group is more than its pl. pk of alanine's carboxyl group is more than its pl. PK of alanine's carboxyl group is less than its pl. pk of alanine's amino group is less than its pl. Correct Answer What fraction of alanine is in the completely uncharged form at its pl? 1 in 2.2 × 107 1 in 1.6 × 10² 1 in 4680 1 in 9460arrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax