Seeley's Anatomy & Physiology
11th Edition
ISBN: 9780077736224
Author: Cinnamon VanPutte, Jennifer Regan, Andrew F. Russo Dr., Rod R. Seeley Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 3, Problem 6CT
Summary Introduction
To determine:
The basis of distinguishing the proteins released from secretory vesicles and the cells in which they have been newly synthesized after the inhibition of messenger ribonucleic acid (mRNA).
Introduction:
In an experiment, the synthesis of mRNA is inhibited with the use of a drug. The mRNA is synthesized by the process of transcription, in which the DNA (deoxyribonucleic acid) is converted to mRNA. After this event, the mRNA gets exported out of the nucleus to cytosol, where ribosomes catalyze the formation of proteins by the process of translation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 3 Solutions
Seeley's Anatomy & Physiology
Ch. 3.1 - What parts are common to most cells?Ch. 3.1 - Explain the four characteristic functions of the...Ch. 3.2 - Which cell features can be seen with a light...Ch. 3.3 - Explain five functions of the plasma membrane.Ch. 3.3 - Prob. 5AYPCh. 3.3 - Prob. 6AYPCh. 3.3 - What are the main chemical components of the...Ch. 3.4 - Prob. 8AYPCh. 3.4 - Summarize the characteristics of the fluid-mosaic...Ch. 3.4 - Prob. 10AYP
Ch. 3.5 - Prob. 11AYPCh. 3.5 - Prob. 12AYPCh. 3.5 - What are the three classes of transport proteins?Ch. 3.5 - Describe specificity, competition, and saturation...Ch. 3.5 - Prob. 15AYPCh. 3.5 - Prob. 16AYPCh. 3.5 - Prob. 17AYPCh. 3.5 - Prob. 18AYPCh. 3.5 - Prob. 19AYPCh. 3.5 - Prob. 20AYPCh. 3.6 - Explain why the plasma membrane is selectively...Ch. 3.6 - Prob. 22AYPCh. 3.6 - Describe how the amount of solute in a solvent...Ch. 3.6 - How is the rate of diffusion affected by an...Ch. 3.6 - Prob. 25AYPCh. 3.6 - Compare isosmotic, hyperosmotic, and hyposmotic...Ch. 3.6 - Prob. 27AYPCh. 3.6 - Prob. 28AYPCh. 3.6 - What is secondary active transport? Describe how...Ch. 3.6 - Prob. 30AYPCh. 3.6 - Prob. 31AYPCh. 3.6 - Prob. 32AYPCh. 3.6 - Describe and give examples of exocytosis.Ch. 3.7 - Prob. 34AYPCh. 3.7 - Prob. 35AYPCh. 3.7 - List and describe the functions of microtubules,...Ch. 3.7 - What are cytoplasmic inclusions? Give several...Ch. 3.8 - Define organelles. Are oil orgonelles found in oil...Ch. 3.8 - Describe the structure of the nucleus and the...Ch. 3.8 - Prob. 40AYPCh. 3.8 - Prob. 41AYPCh. 3.8 - Prob. 42AYPCh. 3.8 - What molecules combine to form ribosomes? Where...Ch. 3.8 - Prob. 44AYPCh. 3.8 - Prob. 45AYPCh. 3.8 - What are the functions of the rough endoplasmic...Ch. 3.8 - Prob. 47AYPCh. 3.8 - Relate the structure and function of the Golgi...Ch. 3.8 - Prob. 49AYPCh. 3.8 - Prob. 50AYPCh. 3.8 - Prob. 51AYPCh. 3.8 - Prob. 52AYPCh. 3.8 - What are the structure and function of...Ch. 3.8 - Describe the structure of a mitochondrion. How...Ch. 3.8 - What enzymes are found on the cristae? In the...Ch. 3.8 - What is the centrosome? Relate the structure of...Ch. 3.8 - What are spindle fibers? Explain the relationship...Ch. 3.8 - Prob. 58AYPCh. 3.8 - Prob. 59AYPCh. 3.9 - Prob. 60AYPCh. 3.9 - Prob. 61AYPCh. 3.9 - Prob. 62AYPCh. 3.9 - Prob. 63AYPCh. 3.9 - Prob. 64AYPCh. 3.9 - Prob. 65AYPCh. 3.9 - Prob. 66AYPCh. 3.9 - Place the steps of translation in sequence. In...Ch. 3.9 - Prob. 68AYPCh. 3.9 - State two ways the cell controls what part of DNA...Ch. 3.10 - Describe the cell’s activities during the G1, S....Ch. 3.10 - Prob. 71AYPCh. 3.10 - Prob. 72AYPCh. 3.10 - Prob. 73AYPCh. 3.10 - Differentiate among chromot in, chromcitids, and...Ch. 3.10 - Prob. 75AYPCh. 3.10 - Prob. 76AYPCh. 3.10 - Prob. 77AYPCh. 3.11 - Prob. 78AYPCh. 3 - In the plasma membrane, _____ form(s) the lipid...Ch. 3 - Which of the following functioning proteins are...Ch. 3 - In general, lipid-soluble molecules diffuse...Ch. 3 - Small pieces of matter, and even whole cells, can...Ch. 3 - The rate of diffusion increases if the a....Ch. 3 - Concerning the process of diffusion, at...Ch. 3 - Prob. 7RACCh. 3 - Prob. 8RACCh. 3 - Which of these statements about facilitated...Ch. 3 - Which of these statements concerning the symport...Ch. 3 - A white blood cell ingests solid particles by...Ch. 3 - Given these characteristics: (1) requires energy...Ch. 3 - Cytoplasm is found a. in the nucleus. b. outside...Ch. 3 - Which of these elements of the cytoskeleton is...Ch. 3 - A large structure, normally visible in the nucleus...Ch. 3 - A cell that synthesizes large amounts of protein...Ch. 3 - Which of thes organelles produces large amounts of...Ch. 3 - Prob. 18RACCh. 3 - A portion of an mRNA molecule that determines one...Ch. 3 - In which of these organelles is m RNA synthesized?...Ch. 3 - During the cell cycle, DNA replication occurs...Ch. 3 - Given the following activities: Repair Growht...Ch. 3 - Apoptosis Is a programmed cell death. Removes...Ch. 3 - Prob. 1CTCh. 3 - Prob. 2CTCh. 3 - Prob. 3CTCh. 3 - Prob. 4CTCh. 3 - Luke started a training program at the beginning...Ch. 3 - Prob. 6CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
The Cell Membrane; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=AsffT7XIXbA;License: Standard youtube license