HUMAN ANATOMY
6th Edition
ISBN: 9781260986037
Author: SALADIN
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Question
Chapter 3, Problem 3.3.13AYLO
Summary Introduction
To determine:
The relation of periosteum to the bone.
Introduction:
Bone is an important part of the skeletal system. It provides strength, support, and framework to the body. There are many types of bones, such as short bones, long bones, and many more. The connection between the two bones is known as joints.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 3 Solutions
HUMAN ANATOMY
Ch. 3.1 - Define tissue and distinguish a tissue from a cell...Ch. 3.1 - Prob. 2BYGOCh. 3.1 - Prob. 3BYGOCh. 3.1 - Prob. 4BYGOCh. 3.1 - Prob. 5BYGOCh. 3.2 - Distinguish between simple and stratified...Ch. 3.2 - Prob. 7BYGOCh. 3.2 - Prob. 8BYGOCh. 3.2 - Prob. 9BYGOCh. 3.2 - Prob. 10BYGO
Ch. 3.2 - Explain how urothelium is specifically adapted to...Ch. 3.3 - When the following tissues are injured, which do...Ch. 3.3 - Prob. 12BYGOCh. 3.3 - Prob. 13BYGOCh. 3.3 - Prob. 14BYGOCh. 3.3 - Prob. 15BYGOCh. 3.3 - Discuss the difference between dense regular and...Ch. 3.3 - Describe some similarities, differences, and...Ch. 3.3 - What are the three basic kinds of formed elements...Ch. 3.4 - Although the nuclei of a muscle fiber are pressed...Ch. 3.4 - What do nervous muscular tissue have in common?...Ch. 3.4 - What are the two basic types of cells in nervous...Ch. 3.4 - Name the three kinds of muscular tissue, describe...Ch. 3.5 - Distinguish between a simple gland and a compound...Ch. 3.5 - Prob. 23BYGOCh. 3.5 - Prob. 24BYGOCh. 3.5 - Prob. 25BYGOCh. 3.6 - What functions of a ciliated pseudostratified...Ch. 3.6 - Tissues can grow through an increase in cell size...Ch. 3.6 - Distinguish between differentiation and...Ch. 3.6 - Distinguish between regeneration and fibrosis....Ch. 3.6 - Prob. 29BYGOCh. 3 - Prob. 3.1.1AYLOCh. 3 - Prob. 3.1.2AYLOCh. 3 - Prob. 3.1.3AYLOCh. 3 - Prob. 3.1.4AYLOCh. 3 - Prob. 3.1.5AYLOCh. 3 - Prob. 3.1.6AYLOCh. 3 - Prob. 3.1.7AYLOCh. 3 - Prob. 3.2.1AYLOCh. 3 - The location, composition, and functions of a...Ch. 3 - Prob. 3.2.3AYLOCh. 3 - Prob. 3.2.4AYLOCh. 3 - The appearance, representative locations, and...Ch. 3 - Prob. 3.2.6AYLOCh. 3 - Differences in structure, location, and function...Ch. 3 - The process of exfoliation and a clinical...Ch. 3 - Prob. 3.3.1AYLOCh. 3 - Prob. 3.3.2AYLOCh. 3 - The types of connective tissue classified as...Ch. 3 - Prob. 3.3.4AYLOCh. 3 - The distinction between loose and dense fibrous...Ch. 3 - The appearance, representative locations, and...Ch. 3 - The appearance, representative locations, and...Ch. 3 - Prob. 3.3.8AYLOCh. 3 - Prob. 3.3.9AYLOCh. 3 - The relationship of the perichondrium to...Ch. 3 - Prob. 3.3.11AYLOCh. 3 - Prob. 3.3.12AYLOCh. 3 - Prob. 3.3.13AYLOCh. 3 - Prob. 3.3.14AYLOCh. 3 - Prob. 3.3.15AYLOCh. 3 - Why blood is considered a connective tissueCh. 3 - Prob. 3.3.17AYLOCh. 3 - Prob. 3.3.18AYLOCh. 3 - The meaning of cell excitability, and why nervous...Ch. 3 - Prob. 3.4.2AYLOCh. 3 - Prob. 3.4.3AYLOCh. 3 - Prob. 3.4.4AYLOCh. 3 - The defining characteristics of muscular tissue as...Ch. 3 - Prob. 3.4.6AYLOCh. 3 - Prob. 3.4.7AYLOCh. 3 - The microscopio representative locations, and...Ch. 3 - Prob. 3.5.1AYLOCh. 3 - The distinction between exocrine and eadocrine...Ch. 3 - Prob. 3.5.3AYLOCh. 3 - Prob. 3.5.4AYLOCh. 3 - Prob. 3.5.5AYLOCh. 3 - Prob. 3.5.6AYLOCh. 3 - The distinctions between eccrine, apocrine, and...Ch. 3 - Prob. 3.5.8AYLOCh. 3 - The tissue layers of a mucous membrane and of a...Ch. 3 - The nature and locations of endothelium,...Ch. 3 - Prob. 3.6.1AYLOCh. 3 - The difference between differentiation and...Ch. 3 - Two ways in which the body repairs damaged...Ch. 3 - The meaning of tissue atrophy, its causes, and...Ch. 3 - Prob. 3.6.5AYLOCh. 3 - Prob. 3.6.6AYLOCh. 3 - Prob. 1TYRCh. 3 - Prob. 2TYRCh. 3 - Prob. 3TYRCh. 3 - A seminiferous tubule of the testis is lined with...Ch. 3 - Prob. 5TYRCh. 3 - Prob. 6TYRCh. 3 - Prob. 7TYRCh. 3 - Tendons are composed of _________ connective...Ch. 3 - The shape of the external ear is due to skeletan...Ch. 3 - The most abundant formed elements(s) of blood...Ch. 3 - Prob. 11TYRCh. 3 - Prob. 12TYRCh. 3 - Prob. 13TYRCh. 3 - Prob. 14TYRCh. 3 - Tendons and ligaments are made mainly of the...Ch. 3 - Prob. 16TYRCh. 3 - Prob. 17TYRCh. 3 - Prob. 18TYRCh. 3 - Prob. 19TYRCh. 3 - Prob. 20TYRCh. 3 - Prob. 1BYMVCh. 3 - Prob. 2BYMVCh. 3 - Prob. 3BYMVCh. 3 - Prob. 4BYMVCh. 3 - Prob. 5BYMVCh. 3 - State a meaning of each word element and give a...Ch. 3 - State a meaning of each word element and give a...Ch. 3 - State a meaning of each word element and give a...Ch. 3 - Prob. 9BYMVCh. 3 - Prob. 10BYMVCh. 3 - Prob. 1WWWTSCh. 3 - Prob. 2WWWTSCh. 3 - Prob. 3WWWTSCh. 3 - Prob. 4WWWTSCh. 3 - Prob. 5WWWTSCh. 3 - Prob. 6WWWTSCh. 3 - Prob. 7WWWTSCh. 3 - Prob. 8WWWTSCh. 3 - Prob. 9WWWTSCh. 3 - Prob. 10WWWTSCh. 3 - Prob. 1TYCCh. 3 - Prob. 2TYCCh. 3 - Prob. 3TYCCh. 3 - Prob. 4TYCCh. 3 - Some human cells are incapable of mitosis...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningUnderstanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:CengageMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
The Musculoskeletal System | Educational Videos for Kids; Author: Happy Learning English;https://www.youtube.com/watch?v=ynVRDsDC-84;License: Standard youtube license