
Concept explainers
Introduction:
Oxidation is a reaction in which addition of oxygen happens or release of electron takes place of when the release of hydrogen occurs. The oxidation of glucose in the cells occurs along with the formation of ATP (adenosine triphosphate), they are known as the energy currency of the cells. Carbon dioxide and oxygen are also released. When a molecule of glucose undergoes oxidation in the cell, the oxygen molecule reacts with the hydrogen molecules and form water molecules. This entire reaction is named

Answer to Problem 1E
Correct answer:
Option (b) is the correct answer. When glucose compound undergoes oxidation in the cells, oxygen reacts with hydrogen ion and forms water.
Explanation of Solution
Explanation/justification for the correct answer:
Here in this reaction, glucose molecule is oxidized to release carbon dioxide and oxygen is reduced to form water by combining with the hydrogen ions.
This entire reaction can be given by the equation:
Thus, option (b) is the correct answer i.e., oxygen reacts with a hydrogen ion and form water by getting reduced.
Explanation for the incorrect answer:
Option (a) is incorrect since oxygen atoms gain electrons from the hydrogen and not carbon, so it produces water and not carbon dioxide.
Option (c) is also not correct as finally the electron is accepted by oxygen. Oxygen receives this electron directly from hydrogen and forms water molecules.
Option (d) is also incorrect since the formation of ATP is different than this reaction which doesn’t require oxygen atom for that reaction.
Option (e) is not true as the formation of acetate from acetyl CoA involves citric acid cycle or Krebs cycle which doesn’t include oxidation of glucose.
We can hence conclude that option (b) is the correct answer, that is, oxygen reacts with a hydrogen ion and form water by getting reduced.
Want to see more full solutions like this?
Chapter 3 Solutions
Pearson eText Principles of Human Physiology -- Instant Access (Pearson+)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





