
Concept explainers
Energy in ATP is used to power skeletal muscle contraction. This is an example of what type of energy conversion?
- a. chemical energy to mechanical energy
- b. light energy to mechanical energy
- c. chemical energy to light energy
- d. electrical energy to chemical energy

Introduction:
The skeletal system is that organ system that is related to movement. It is composed of skeletal muscles and bones. It consists of 206 bones, tendons, and ligaments. It also provides supports, production of blood cells, calcium storage and regulation of the endocrine system.
Answer to Problem 1DYKB
Correct answer:
Energy in ATP is utilized in providing strength to skeletal muscles for contraction. This is an example of conversion of chemical energy to mechanical energy. Therefore, option a. is correct.
Explanation of Solution
Reason for the correct statement:
Option a. is given as “chemical energy to mechanical energy”. Chemical energy is the energy that is stored in chemicals or compounds. Mechanical energy is that type of energy that is related to motion and position of anything or any organism. When there is a muscular contraction then there is the use of ATP which is a chemical compound. So, there is a conversion of stored chemical energy to mechanical energy as a result of which there is a contraction in the skeletal muscles. Hence, there is the conversion of chemical energy to mechanical energy in the case of muscular contraction.
Hence, option a. is correct.
Reasons for incorrect statements:
Option b. is given as “light energy to mechanical energy”. Energy stored in ATP is chemical energy and not light energy. Hence, option b. is incorrect.
Option c. is given as “chemical energy to light energy”. There is a use of mechanical energy and not light energy in the process of contraction of muscles. Hence, option c. is incorrect.
Option d. is given as “electrical energy to chemical energy”. In ATP there is chemical energy and not electrical energy. Hence, option d. is incorrect.
Hence, options b., c., and d. are incorrect.
In the process of contraction of muscles of the skeleton, there is the conversion of chemical to mechanical energy as the energy stored in ATP is chemical energy.
Want to see more full solutions like this?
Chapter 3 Solutions
Anatomy & Physiology: An Integrative Approach
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning




