Essential Cell Biology (fifth Edition)
Essential Cell Biology (fifth Edition)
5th Edition
ISBN: 9780393680362
Author: ALBERTS, Bruce, Hopkin, Karen, Johnson -
Publisher: W. W. Norton & Company
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 3, Problem 17Q

A.

Summary Introduction

To determine: Whether it is safe to eat a mushroom that bears a mutation in which the enzyme that catalyzes the reaction prevents the utilization of ATP.

Introduction: Enzymes are the protein molecules that catalyze the reaction by lowering the activation energy in order to increase the fraction of molecules to attain the transition state and to increase the rate of reaction. Enzyme involving in reactions is thermodynamically feasible because the enzymes lower the activation energy barrier that slows down the rate of reaction.

Summary Introduction

To determine: The amount of less poison that the mutant mushroom would produce when the reaction is at equilibrium and stored energy in ATP is used to drive the unfavorable reaction in nonmutant mushrooms.

Introduction: Enzymes lower the activation energy of reaction in order to increase the fraction of molecules to attain the transition state and to increase the rate of reaction on both the directions. In the biochemical reaction, enzymes are specific catalyst that enhances the rate of reaction in both reverse and forward direction at the point of equilibrium but they never change the difference in free energy and the equilibrium constant.

B.

Summary Introduction

To determine: Whether it is safe or not safe for another mutant mushroom whose enzyme couples the reaction to ATP hydrolysis by working 100 times slower than the previous one.

Introduction: Enzymes are made up of proteins. These are biological catalysts that increase the rate of reaction in the body.

Blurred answer
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Enzyme Kinetics; Author: MIT OpenCourseWare;https://www.youtube.com/watch?v=FXWZr3mscUo;License: Standard Youtube License