Study Guide with Student Solutions Manual and Problems Book for Garrett/Grisham's Biochemistry, 6th
Study Guide with Student Solutions Manual and Problems Book for Garrett/Grisham's Biochemistry, 6th
6th Edition
ISBN: 9798214167343
Author: GARRETT
Publisher: Cengage Learning US
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 29, Problem 1P
Interpretation Introduction

Interpretation:

The nucleotide sequence of the DNA template and the N-terminal amino acid sequence of proton encoded by it need to be determined

Concept introduction:

Nucleic acids and deoxyribonucleic acid particularly, are key macro molecules for the life processes. Deoxyribonucleic acid bears the hereditary data that is transferred to children from their parents, providing directions for the way (and when) to form numerous proteins required to make and maintain the cell functioning in the organisms.

Expert Solution & Answer
Check Mark

Answer to Problem 1P

  Met-Ala-lle-Ser-Thr-Lys-Thr-Pro-Arg-Glu-Ser…

Explanation of Solution

The 3’ end of messenger ribonucleic acid can complement the 5’ end of the deoxyribonucleic acid transcribed from it. The deoxyribonucleic acid sequence can be represented from 5’ to 3’ as follows.

  5’-…GGATTCCCTAGGAGTCTTCGTCGTCGATCGCCATACGGATCT…-3

The amino group end of the aminoalkanoic acid sequence can start from the primary AUG sequence ranging from the 5’ end.

  5’-…AUG GCG AUC UCG ACU AAG ACU CCU AGG GAA UCC…-3’

This ends up in the subsequent organic compound sequence as follows:

  Met-Ala-lle-Ser-Thr-Lys-Thr-Pro-Arg-Glu-Ser…

Conclusion

The 3’ end of ribonucleic acid can complement the 5’ end of the deoxyribonucleic acid transcribed from it. The N-terminal aminoalkanoic acid sequence can begin from the primary AUG sequence ranging from the 5’ end.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
When was the dihydropyridine calcium channel blocker isradipine first patented and by whom? Please provide information on the origin and history of isradipine and who owns it/manufactures it.
9) Below, there is a representation of an SDS-PAGE gel. Assuming the samples in the MW standard have masses of: 66 kDa, 45 kDa, 36 kDa, 29 kDa, 24 kDa, 20.1 kDa, and 14.2 kDa, a) Figure 4: indicate where each of the measurements were taken and label as in II.6. figure 2 above. b) As in II.7. Table 1 above create Table 2 using the data below. Determine the r.f. values for the MW standards, plot the relative mobility versus the log of the mass for the standards, and use the best fit straight line to determine the molecular weights of the proteins in the whey, peak 1, and peak 2 lanes. (5 pts—this will be scaled up appropriately if your gel did not develop properly) dye MW Whey Peak 1 Peak 2
what are the different classes and some examples of neuroprotectants that can be used to treat, prevent, or combat neurotoxicity/a neurotoxicant...for example, antioxidants, nutraceuticals, etc.,..?
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY