Biochemistry
Biochemistry
6th Edition
ISBN: 9781337359573
Author: Reginald H. Garrett; Charles M. Grisham
Publisher: Cengage Learning US
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 29, Problem 1P
Interpretation Introduction

Interpretation:

The nucleotide sequence of the DNA template and the N-terminal amino acid sequence of proton encoded by it need to be determined

Concept introduction:

Nucleic acids and deoxyribonucleic acid particularly, are key macro molecules for the life processes. Deoxyribonucleic acid bears the hereditary data that is transferred to children from their parents, providing directions for the way (and when) to form numerous proteins required to make and maintain the cell functioning in the organisms.

Expert Solution & Answer
Check Mark

Answer to Problem 1P

  Met-Ala-lle-Ser-Thr-Lys-Thr-Pro-Arg-Glu-Ser…

Explanation of Solution

The 3’ end of messenger ribonucleic acid can complement the 5’ end of the deoxyribonucleic acid transcribed from it. The deoxyribonucleic acid sequence can be represented from 5’ to 3’ as follows.

  5’-…GGATTCCCTAGGAGTCTTCGTCGTCGATCGCCATACGGATCT…-3

The amino group end of the aminoalkanoic acid sequence can start from the primary AUG sequence ranging from the 5’ end.

  5’-…AUG GCG AUC UCG ACU AAG ACU CCU AGG GAA UCC…-3’

This ends up in the subsequent organic compound sequence as follows:

  Met-Ala-lle-Ser-Thr-Lys-Thr-Pro-Arg-Glu-Ser…

Conclusion

The 3’ end of ribonucleic acid can complement the 5’ end of the deoxyribonucleic acid transcribed from it. The N-terminal aminoalkanoic acid sequence can begin from the primary AUG sequence ranging from the 5’ end.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
Biochemistry Question. Please help solve. Thank you! Based upon knowledge of oxidation of bioorganic compounds and howmuch energy is released during their oxidation, rank the following, from most to least, with respect to how much energy would be produced from each during their oxidation. Explain your placement for each one.
Biochemistry Question.For the metabolism of amino acids what is the first step for theirbreakdown? Why is it necessary for this breakdown product to be transported to the liver? For the catabolism of the carbon backbone of these amino acids, there are 7 entry points into the “standard” metabolic pathways. List these 7 entry points and which amino acids are metabolized to these entry points. Please help. Thank you!
Biochemistry Question. Please help. Thank you.   You are studying pyruvate utilization in mammals for ATP production under aerobic conditions and have synthesized pyruvate with Carbon #1 labelled with radioactive C14.   After only one complete cycle of the TCA cycle, which of the TCA cycle intermediates would be labeled with C14? Explain your answer.   Interestingly, you find C14 being excreted in the urine. How does it get there?
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
  • Text book image
    Biochemistry
    Biochemistry
    ISBN:9781305577206
    Author:Reginald H. Garrett, Charles M. Grisham
    Publisher:Cengage Learning
    Text book image
    Biology 2e
    Biology
    ISBN:9781947172517
    Author:Matthew Douglas, Jung Choi, Mary Ann Clark
    Publisher:OpenStax
    Text book image
    Biology: The Dynamic Science (MindTap Course List)
    Biology
    ISBN:9781305389892
    Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
    Publisher:Cengage Learning
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY