
To Label: The muscular artery wall in Fig 29.2.
Introduction: The circulatory system is the vital system in the human body and it is composed of heart, blood vessels, and capillaries. The main function of the circulatory system to provide all the organs and tissues with oxygen and nutrients, and help in the removal of

Answer to Problem 1.2BGL
Pictorial representation:
Fig 1: Muscular structure of artery wall
Explanation of Solution
The structure of the muscular arteries is composed of the following:
Tunica interna: The tunica interna or intima is the innermost layer of the arteries which is composed of simple squamous epithelium and inter elastic lamina that provide elasticity to the arteries. The lumen of the arteries is lined up by the endothelium cell that is smooth and helps in smooth blood flow. If there is any damage to the arteries, the endothelium helps the platelets to bind to the walls of the arteries and form plaques to reduce the blood flow, as the arterial blood pressure is high which may cause excessive blood loss.
Tunica media: The tunica media is the middle layer of the arterial wall and it is the thickest of the tunics. The tunica media is composed of elastic fibers and smooth muscle fibers that regulate the flow of blood by vasodilation and vasoconstriction. The elastic fibers help the artery to retain its original structure after vasodilation and vasoconstriction of the smooth muscle fibers.
Tunica externa: The tunica externa is the outermost layer of the arteries and composed of collagen fibers and elastic fibers. The collagen fibers are the connective tissue which provides the blood vessel with support and protection, while the elastic fibers provide with flexibility and elasticity to constrict, dilate, and to retain its original structure.
Basement membrane: The tunica interna is composed of simple squamous endothelium. The tunica interna is the supported basement membrane which is made up of extracellular matrix that gives structural stability to the endothelium cells of the tunica interna.
External elastic lamina: The external elastic lamina is found between the tunica externa and tunia media. The external elastic lamina is composed of elastic fibers and collagen. The external elastic lamina provides the tunica media with elasticity to vasoconstrict and vasodilate.
Internal elastic lamina: The internal elastic lamina is found between the tunica media and tunia interna. The internal elastic lamina is composed of elastic fibers and collagen. The internal elastic lamina provides the tunica media and tunica interna with elasticity to vasoconstrict and vasodilate.
Smooth muscle: The smooth muscle is present in the tunica media of the arteries, which is the thickest of the three layers of the tunics. The smooth muscle helps in the vasocontrict and vasodilate of the arteries to maintain blood flow.
Endothelium: The endothelium is present in the tunica interna of the arteries, which is composed of simple squamous epithelial cells. The lumen of the arteries is lined up by the endothelium cell that is smooth and helps in smooth blood flow.
Want to see more full solutions like this?
Chapter 29 Solutions
Laboratory Manual for Anatomy and Physiology, 6e Loose-Leaf Print Companion
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





