The base sequence of mRNA that can be transcribed from the given strand ( 5 ′ ) C T T A A C A C C C C T G A C T T C G C G C C G T C G ( 3 ′ ) . Introduction: The double –stranded DNA is also known as duplex DNA. The template DNA obtained from the double stranded DNA act as the template for RNA. The non template strand is similar to the sequence of RNA.

Question

Want to see more full solutions like this?

Answer 1

Question

Chapter 27, Problem 4P

(a)

Summary Introduction

To determine: The base sequence of mRNA that can be transcribed from the given strand (5′)CTT AACACCCCTGACTTCGCGCCGTCG(3′).

Introduction:

The double –stranded DNA is also known as duplex DNA. The template DNA obtained from the double stranded DNA act as the template for RNA. The non template strand is similar to the sequence of RNA.

(a)

Expert Solution

Explanation of Solution

The only change is that the DNA consists of thymine and RNA consists of uracil in place of thymine.

The mRNA strand that can be obtained from the transcription of template strand is given as,

(5′)CTTAACACCCCTGACTTCGCGCCGTCG(3′)↓ Transcription(3′)GAAUUGUGGGGACUGAAGCGCGGCAGC(5′)

(b)

Summary Introduction

To determine: The amino acid sequence that could be coded by the mRNA in (a), starting from the 5′ end.

Introduction:

The DNA is made up of two strands which inter wined with each other. Almost 300 different macromolecules incorporate to synthesize polypeptides. All the living organisms consist of similar type of genetic codes. The proteins are synthesized by the genetic codons.

(b)

Expert Solution

Explanation of Solution

The amino acids specify by mRNA sequences are as follow:

CGA-CGG-CGC-GAA-GUC-AGG-GGU-GUU-AAGArg -Arg - Arg - Glu - Val - Arg - Gly - Val - Lys

The 3 codons CGA specify the arginine amino acid, GAA specifies glutamine, GUC specifies valine, AGG specify amino acid arginine, 2 GGU codons specify glycine, GUU specifies valine and AAG specifies lysine. Thus, the amino acids which are specified by codons are leucine, alanine, valine and glutamine.

(c)

Summary Introduction

To determine: The resulting amino acid sequence is same or not, if the complementary (non template) strand of this DNA were transcribed and translated. Also explain the biological significance.

Introduction:

The proteins are synthesized by the genetic codons. Similar type of genetic codes is present in all the living organisms. These ribosomes link specific amino acids in a sequence which is specified by codons.

(c)

Expert Solution

Explanation of Solution

The complementary strand is antiparallel strand that does not have the same sequence in the opposite direction.

The amino acids which are encoded by the mRNA sequence obtained in (b) are:

(5′)C T T A A C A C C C C T G A C T T C G C G C C G T C G (3′)(3′)G A A T T G T G G G G A C T G A A G C G C G G C A G C (5′)↓ Transcription(5′) C U U A A C A C C C C U G A C U U C G C G C C G U C G(3′)

This is the obtained sequence of mRNA that by non-template strand.

(5′)CUU-AAC-ACC-CCU-GAC-UUC-GCG-CCG-UCG (3′) Leu - Asn -Thr − Pro - Asp - Phe - Ala - Pro - Ser

The biological significance is that the RNA includes transcription from only one strand of duplex DNA which is specific. The RNA polymerase binds to the correct strand of DNA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

Compare and contrast primary and secondary active transport mechanisms in terms of energy utilisation and efficiency. Provide examples of each and discuss their physiological significance in maintaining ionic balance and nutrient uptake. Rubric Understanding the key concepts (clearly and accurately explains primary and secondary active transport mechanisms, showing a deep understanding of their roles) Energy utilisation analysis ( thoroughly compares energy utilisation in primary and secondary transport with specific and relevant examples Efficiency discussion Use of examples (provides relevant and accurate examples (e.g sodium potassium pump, SGLT1) with clear links to physiological significance. Clarity and structure (presents ideas logically and cohesively with clear organisation and smooth transition between sections)

9. Which one of the compounds below is the major organic product obtained from the following reaction sequence, starting with ethyl acetoacetate? 요요. 1. NaOCH2CH3 CH3CH2OH 1. NaOH, H₂O 2. H3O+ 3. A OCH2CH3 2. ethyl acetoacetate ii A 3. H3O+ OH B C D E

7. Only one of the following ketones cannot be made via an acetoacetic ester synthesis. Which one is it? Ph کہ A B C D E

Answer 2

Question

Chapter 27, Problem 4P

(a)

Summary Introduction

To determine: The base sequence of mRNA that can be transcribed from the given strand (5′)CTT AACACCCCTGACTTCGCGCCGTCG(3′).

Introduction:

The double –stranded DNA is also known as duplex DNA. The template DNA obtained from the double stranded DNA act as the template for RNA. The non template strand is similar to the sequence of RNA.

(a)

Expert Solution

Explanation of Solution

The only change is that the DNA consists of thymine and RNA consists of uracil in place of thymine.

The mRNA strand that can be obtained from the transcription of template strand is given as,

(5′)CTTAACACCCCTGACTTCGCGCCGTCG(3′)↓ Transcription(3′)GAAUUGUGGGGACUGAAGCGCGGCAGC(5′)

(b)

Summary Introduction

To determine: The amino acid sequence that could be coded by the mRNA in (a), starting from the 5′ end.

Introduction:

The DNA is made up of two strands which inter wined with each other. Almost 300 different macromolecules incorporate to synthesize polypeptides. All the living organisms consist of similar type of genetic codes. The proteins are synthesized by the genetic codons.

(b)

Expert Solution

Explanation of Solution

The amino acids specify by mRNA sequences are as follow:

CGA-CGG-CGC-GAA-GUC-AGG-GGU-GUU-AAGArg -Arg - Arg - Glu - Val - Arg - Gly - Val - Lys

The 3 codons CGA specify the arginine amino acid, GAA specifies glutamine, GUC specifies valine, AGG specify amino acid arginine, 2 GGU codons specify glycine, GUU specifies valine and AAG specifies lysine. Thus, the amino acids which are specified by codons are leucine, alanine, valine and glutamine.

(c)

Summary Introduction

To determine: The resulting amino acid sequence is same or not, if the complementary (non template) strand of this DNA were transcribed and translated. Also explain the biological significance.

Introduction:

The proteins are synthesized by the genetic codons. Similar type of genetic codes is present in all the living organisms. These ribosomes link specific amino acids in a sequence which is specified by codons.

(c)

Expert Solution

Explanation of Solution

The complementary strand is antiparallel strand that does not have the same sequence in the opposite direction.

The amino acids which are encoded by the mRNA sequence obtained in (b) are:

(5′)C T T A A C A C C C C T G A C T T C G C G C C G T C G (3′)(3′)G A A T T G T G G G G A C T G A A G C G C G G C A G C (5′)↓ Transcription(5′) C U U A A C A C C C C U G A C U U C G C G C C G U C G(3′)

This is the obtained sequence of mRNA that by non-template strand.

(5′)CUU-AAC-ACC-CCU-GAC-UUC-GCG-CCG-UCG (3′) Leu - Asn -Thr − Pro - Asp - Phe - Ala - Pro - Ser

The biological significance is that the RNA includes transcription from only one strand of duplex DNA which is specific. The RNA polymerase binds to the correct strand of DNA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Question

Chapter 27, Problem 4P

(a)

Summary Introduction

To determine: The base sequence of mRNA that can be transcribed from the given strand (5′)CTT AACACCCCTGACTTCGCGCCGTCG(3′).

Introduction:

The double –stranded DNA is also known as duplex DNA. The template DNA obtained from the double stranded DNA act as the template for RNA. The non template strand is similar to the sequence of RNA.

(a)

Expert Solution

Explanation of Solution

The only change is that the DNA consists of thymine and RNA consists of uracil in place of thymine.

The mRNA strand that can be obtained from the transcription of template strand is given as,

(5′)CTTAACACCCCTGACTTCGCGCCGTCG(3′)↓ Transcription(3′)GAAUUGUGGGGACUGAAGCGCGGCAGC(5′)

(b)

Summary Introduction

To determine: The amino acid sequence that could be coded by the mRNA in (a), starting from the 5′ end.

Introduction:

The DNA is made up of two strands which inter wined with each other. Almost 300 different macromolecules incorporate to synthesize polypeptides. All the living organisms consist of similar type of genetic codes. The proteins are synthesized by the genetic codons.

(b)

Expert Solution

Explanation of Solution

The amino acids specify by mRNA sequences are as follow:

CGA-CGG-CGC-GAA-GUC-AGG-GGU-GUU-AAGArg -Arg - Arg - Glu - Val - Arg - Gly - Val - Lys

The 3 codons CGA specify the arginine amino acid, GAA specifies glutamine, GUC specifies valine, AGG specify amino acid arginine, 2 GGU codons specify glycine, GUU specifies valine and AAG specifies lysine. Thus, the amino acids which are specified by codons are leucine, alanine, valine and glutamine.

(c)

Summary Introduction

To determine: The resulting amino acid sequence is same or not, if the complementary (non template) strand of this DNA were transcribed and translated. Also explain the biological significance.

Introduction:

The proteins are synthesized by the genetic codons. Similar type of genetic codes is present in all the living organisms. These ribosomes link specific amino acids in a sequence which is specified by codons.

(c)

Expert Solution

Explanation of Solution

The complementary strand is antiparallel strand that does not have the same sequence in the opposite direction.

The amino acids which are encoded by the mRNA sequence obtained in (b) are:

(5′)C T T A A C A C C C C T G A C T T C G C G C C G T C G (3′)(3′)G A A T T G T G G G G A C T G A A G C G C G G C A G C (5′)↓ Transcription(5′) C U U A A C A C C C C U G A C U U C G C G C C G U C G(3′)

This is the obtained sequence of mRNA that by non-template strand.

(5′)CUU-AAC-ACC-CCU-GAC-UUC-GCG-CCG-UCG (3′) Leu - Asn -Thr − Pro - Asp - Phe - Ala - Pro - Ser

The biological significance is that the RNA includes transcription from only one strand of duplex DNA which is specific. The RNA polymerase binds to the correct strand of DNA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Question

Chapter 27, Problem 4P

(a)

Summary Introduction

To determine: The base sequence of mRNA that can be transcribed from the given strand (5′)CTT AACACCCCTGACTTCGCGCCGTCG(3′).

Introduction:

The double –stranded DNA is also known as duplex DNA. The template DNA obtained from the double stranded DNA act as the template for RNA. The non template strand is similar to the sequence of RNA.

(a)

Expert Solution

Explanation of Solution

The only change is that the DNA consists of thymine and RNA consists of uracil in place of thymine.

The mRNA strand that can be obtained from the transcription of template strand is given as,

(5′)CTTAACACCCCTGACTTCGCGCCGTCG(3′)↓ Transcription(3′)GAAUUGUGGGGACUGAAGCGCGGCAGC(5′)

(b)

Summary Introduction

To determine: The amino acid sequence that could be coded by the mRNA in (a), starting from the 5′ end.

Introduction:

The DNA is made up of two strands which inter wined with each other. Almost 300 different macromolecules incorporate to synthesize polypeptides. All the living organisms consist of similar type of genetic codes. The proteins are synthesized by the genetic codons.

(b)

Expert Solution

Explanation of Solution

The amino acids specify by mRNA sequences are as follow:

CGA-CGG-CGC-GAA-GUC-AGG-GGU-GUU-AAGArg -Arg - Arg - Glu - Val - Arg - Gly - Val - Lys

The 3 codons CGA specify the arginine amino acid, GAA specifies glutamine, GUC specifies valine, AGG specify amino acid arginine, 2 GGU codons specify glycine, GUU specifies valine and AAG specifies lysine. Thus, the amino acids which are specified by codons are leucine, alanine, valine and glutamine.

(c)

Summary Introduction

To determine: The resulting amino acid sequence is same or not, if the complementary (non template) strand of this DNA were transcribed and translated. Also explain the biological significance.

Introduction:

The proteins are synthesized by the genetic codons. Similar type of genetic codes is present in all the living organisms. These ribosomes link specific amino acids in a sequence which is specified by codons.

(c)

Expert Solution

Explanation of Solution

The complementary strand is antiparallel strand that does not have the same sequence in the opposite direction.

The amino acids which are encoded by the mRNA sequence obtained in (b) are:

(5′)C T T A A C A C C C C T G A C T T C G C G C C G T C G (3′)(3′)G A A T T G T G G G G A C T G A A G C G C G G C A G C (5′)↓ Transcription(5′) C U U A A C A C C C C U G A C U U C G C G C C G U C G(3′)

This is the obtained sequence of mRNA that by non-template strand.

(5′)CUU-AAC-ACC-CCU-GAC-UUC-GCG-CCG-UCG (3′) Leu - Asn -Thr − Pro - Asp - Phe - Ala - Pro - Ser

The biological significance is that the RNA includes transcription from only one strand of duplex DNA which is specific. The RNA polymerase binds to the correct strand of DNA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Chapter 27, Problem 4P

(a)

Summary Introduction

To determine: The base sequence of mRNA that can be transcribed from the given strand (5′)CTT AACACCCCTGACTTCGCGCCGTCG(3′).

Introduction:

The double –stranded DNA is also known as duplex DNA. The template DNA obtained from the double stranded DNA act as the template for RNA. The non template strand is similar to the sequence of RNA.

(a)

Expert Solution

Explanation of Solution

The only change is that the DNA consists of thymine and RNA consists of uracil in place of thymine.

The mRNA strand that can be obtained from the transcription of template strand is given as,

(5′)CTTAACACCCCTGACTTCGCGCCGTCG(3′)↓ Transcription(3′)GAAUUGUGGGGACUGAAGCGCGGCAGC(5′)

(b)

Summary Introduction

To determine: The amino acid sequence that could be coded by the mRNA in (a), starting from the 5′ end.

Introduction:

The DNA is made up of two strands which inter wined with each other. Almost 300 different macromolecules incorporate to synthesize polypeptides. All the living organisms consist of similar type of genetic codes. The proteins are synthesized by the genetic codons.

(b)

Expert Solution

Explanation of Solution

The amino acids specify by mRNA sequences are as follow:

CGA-CGG-CGC-GAA-GUC-AGG-GGU-GUU-AAGArg -Arg - Arg - Glu - Val - Arg - Gly - Val - Lys

The 3 codons CGA specify the arginine amino acid, GAA specifies glutamine, GUC specifies valine, AGG specify amino acid arginine, 2 GGU codons specify glycine, GUU specifies valine and AAG specifies lysine. Thus, the amino acids which are specified by codons are leucine, alanine, valine and glutamine.

(c)

Summary Introduction

To determine: The resulting amino acid sequence is same or not, if the complementary (non template) strand of this DNA were transcribed and translated. Also explain the biological significance.

Introduction:

The proteins are synthesized by the genetic codons. Similar type of genetic codes is present in all the living organisms. These ribosomes link specific amino acids in a sequence which is specified by codons.

(c)

Expert Solution

Explanation of Solution

The complementary strand is antiparallel strand that does not have the same sequence in the opposite direction.

The amino acids which are encoded by the mRNA sequence obtained in (b) are:

(5′)C T T A A C A C C C C T G A C T T C G C G C C G T C G (3′)(3′)G A A T T G T G G G G A C T G A A G C G C G G C A G C (5′)↓ Transcription(5′) C U U A A C A C C C C U G A C U U C G C G C C G U C G(3′)

This is the obtained sequence of mRNA that by non-template strand.

(5′)CUU-AAC-ACC-CCU-GAC-UUC-GCG-CCG-UCG (3′) Leu - Asn -Thr − Pro - Asp - Phe - Ala - Pro - Ser

The biological significance is that the RNA includes transcription from only one strand of duplex DNA which is specific. The RNA polymerase binds to the correct strand of DNA.

Answer 6

Chapter 27, Problem 4P

(a)

Summary Introduction

To determine: The base sequence of mRNA that can be transcribed from the given strand (5′)CTT AACACCCCTGACTTCGCGCCGTCG(3′).

Introduction:

The double –stranded DNA is also known as duplex DNA. The template DNA obtained from the double stranded DNA act as the template for RNA. The non template strand is similar to the sequence of RNA.

(a)

Expert Solution

Explanation of Solution

The only change is that the DNA consists of thymine and RNA consists of uracil in place of thymine.

The mRNA strand that can be obtained from the transcription of template strand is given as,

(5′)CTTAACACCCCTGACTTCGCGCCGTCG(3′)↓ Transcription(3′)GAAUUGUGGGGACUGAAGCGCGGCAGC(5′)

Answer 7

Chapter 27, Problem 4P

(a)

Summary Introduction

To determine: The base sequence of mRNA that can be transcribed from the given strand (5′)CTT AACACCCCTGACTTCGCGCCGTCG(3′).

Introduction:

The double –stranded DNA is also known as duplex DNA. The template DNA obtained from the double stranded DNA act as the template for RNA. The non template strand is similar to the sequence of RNA.

Answer 8

(a)

Expert Solution

Explanation of Solution

The only change is that the DNA consists of thymine and RNA consists of uracil in place of thymine.

The mRNA strand that can be obtained from the transcription of template strand is given as,

(5′)CTTAACACCCCTGACTTCGCGCCGTCG(3′)↓ Transcription(3′)GAAUUGUGGGGACUGAAGCGCGGCAGC(5′)

Answer 9

(a)

Expert Solution

Answer 10

(a)

Expert Solution

Answer 11

Expert Solution

Answer 12

(b)

Summary Introduction

To determine: The amino acid sequence that could be coded by the mRNA in (a), starting from the 5′ end.

Introduction:

The DNA is made up of two strands which inter wined with each other. Almost 300 different macromolecules incorporate to synthesize polypeptides. All the living organisms consist of similar type of genetic codes. The proteins are synthesized by the genetic codons.

(b)

Expert Solution

Explanation of Solution

The amino acids specify by mRNA sequences are as follow:

CGA-CGG-CGC-GAA-GUC-AGG-GGU-GUU-AAGArg -Arg - Arg - Glu - Val - Arg - Gly - Val - Lys

The 3 codons CGA specify the arginine amino acid, GAA specifies glutamine, GUC specifies valine, AGG specify amino acid arginine, 2 GGU codons specify glycine, GUU specifies valine and AAG specifies lysine. Thus, the amino acids which are specified by codons are leucine, alanine, valine and glutamine.

Answer 13

(b)

Summary Introduction

To determine: The amino acid sequence that could be coded by the mRNA in (a), starting from the 5′ end.

Introduction:

The DNA is made up of two strands which inter wined with each other. Almost 300 different macromolecules incorporate to synthesize polypeptides. All the living organisms consist of similar type of genetic codes. The proteins are synthesized by the genetic codons.

Answer 14

(b)

Expert Solution

Explanation of Solution

The amino acids specify by mRNA sequences are as follow:

CGA-CGG-CGC-GAA-GUC-AGG-GGU-GUU-AAGArg -Arg - Arg - Glu - Val - Arg - Gly - Val - Lys

The 3 codons CGA specify the arginine amino acid, GAA specifies glutamine, GUC specifies valine, AGG specify amino acid arginine, 2 GGU codons specify glycine, GUU specifies valine and AAG specifies lysine. Thus, the amino acids which are specified by codons are leucine, alanine, valine and glutamine.

Answer 15

(b)

Expert Solution

Answer 16

(b)

Expert Solution

Answer 17

Expert Solution

Answer 18

(c)

Summary Introduction

To determine: The resulting amino acid sequence is same or not, if the complementary (non template) strand of this DNA were transcribed and translated. Also explain the biological significance.

Introduction:

The proteins are synthesized by the genetic codons. Similar type of genetic codes is present in all the living organisms. These ribosomes link specific amino acids in a sequence which is specified by codons.

(c)

Expert Solution

Explanation of Solution

The complementary strand is antiparallel strand that does not have the same sequence in the opposite direction.

The amino acids which are encoded by the mRNA sequence obtained in (b) are:

(5′)C T T A A C A C C C C T G A C T T C G C G C C G T C G (3′)(3′)G A A T T G T G G G G A C T G A A G C G C G G C A G C (5′)↓ Transcription(5′) C U U A A C A C C C C U G A C U U C G C G C C G U C G(3′)

This is the obtained sequence of mRNA that by non-template strand.

(5′)CUU-AAC-ACC-CCU-GAC-UUC-GCG-CCG-UCG (3′) Leu - Asn -Thr − Pro - Asp - Phe - Ala - Pro - Ser

The biological significance is that the RNA includes transcription from only one strand of duplex DNA which is specific. The RNA polymerase binds to the correct strand of DNA.

Answer 19

(c)

Summary Introduction

To determine: The resulting amino acid sequence is same or not, if the complementary (non template) strand of this DNA were transcribed and translated. Also explain the biological significance.

Introduction:

The proteins are synthesized by the genetic codons. Similar type of genetic codes is present in all the living organisms. These ribosomes link specific amino acids in a sequence which is specified by codons.

Answer 20

(c)

Expert Solution

Explanation of Solution

The complementary strand is antiparallel strand that does not have the same sequence in the opposite direction.

The amino acids which are encoded by the mRNA sequence obtained in (b) are:

(5′)C T T A A C A C C C C T G A C T T C G C G C C G T C G (3′)(3′)G A A T T G T G G G G A C T G A A G C G C G G C A G C (5′)↓ Transcription(5′) C U U A A C A C C C C U G A C U U C G C G C C G U C G(3′)

This is the obtained sequence of mRNA that by non-template strand.

(5′)CUU-AAC-ACC-CCU-GAC-UUC-GCG-CCG-UCG (3′) Leu - Asn -Thr − Pro - Asp - Phe - Ala - Pro - Ser

The biological significance is that the RNA includes transcription from only one strand of duplex DNA which is specific. The RNA polymerase binds to the correct strand of DNA.