Concept explainers
To determine: The sequences of the mature RNA.
Concept introduction: The sequence of the three mRNA
Given: The sequence of the sense strand of a mammalian gene is as follows:
TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT
Assume that: The transcription initiates at a G, which is approximately 25bp downstream of the TATAATA sequence, in which each 5′ splice site has the sequence AG/GUAAGU, and that each 3′ splice site has the sequence CAG/G, where / marks the location of the splice.
To determine: The sequences of encoded protein.
Concept introduction: The sequence of the three mRNA nucleotides that codes for the amino acids during the translation process is called codon. Three nucleotides constitute a codon that codes for the single amino acid. The codon where the translation process initiates is the start codon, which is usually AUG that codes for methionine. The stop codon terminates the translation process. The stop codons are UAA, UGA, and UAG.
Given: The sequence of the sense strand of a mammalian gene is as follows:
TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT
Assume that: The transcription initiates at a G, which is approximately 25bp downstream of the TATAATA sequence, in which each 5′ splice site has the sequence AG/GUAAGU, and that each 3′ splice site has the sequence CAG/G, where / marks the location of the splice.
Trending nowThis is a popular solution!
Chapter 27 Solutions
FUNDAMENTALS OF BIOCHEMISTRY - LL FD
- Biochemistry Question Please help. Thank you What is the function of glutamate dehydrogenase?arrow_forwardBiochemistry Question Please help. Thank you How and why does a high protein diet affect the enzymes of the urea cycle?arrow_forwardBiochemistry What is the importance of the glucose-alanine cycle?arrow_forward
- Biochemistry Assuming 2.5 molecules of ATP per oxidation of NADH/(H+) and 1.5molecules of ATP per oxidation of FADH2, how many ATP are produced per molecule of pyruvate? Please help. Thank youarrow_forward1. How would you explain the term ‘good food’? 2. How would you define Nutrition? 3. Nutrients are generally categorised into two forms. Discuss.arrow_forwardBiochemistry Question. Please help solve. Thank you! Based upon knowledge of oxidation of bioorganic compounds and howmuch energy is released during their oxidation, rank the following, from most to least, with respect to how much energy would be produced from each during their oxidation. Explain your placement for each one.arrow_forward
- Biochemistry Question.For the metabolism of amino acids what is the first step for theirbreakdown? Why is it necessary for this breakdown product to be transported to the liver? For the catabolism of the carbon backbone of these amino acids, there are 7 entry points into the “standard” metabolic pathways. List these 7 entry points and which amino acids are metabolized to these entry points. Please help. Thank you!arrow_forwardBiochemistry Question. Please help. Thank you. You are studying pyruvate utilization in mammals for ATP production under aerobic conditions and have synthesized pyruvate with Carbon #1 labelled with radioactive C14. After only one complete cycle of the TCA cycle, which of the TCA cycle intermediates would be labeled with C14? Explain your answer. Interestingly, you find C14 being excreted in the urine. How does it get there?arrow_forwardBiochemistry question. Please help with. Thanks in advance For each of the enzymes listed below, explain what the enzyme does including function, names (or structures) of the substrate and products and the pathway(s) (if applicable) it is/are found in. (a) ATP synthetase (b) succinate dehydrogenase (c) isocitrate lyase (d) acetyl CoA carboxylase (e) isocitrate dehydrogenase (f) malate dehydrogenasearrow_forward
- Draw and name each alcohol and classify it as primary, secondary, or tertiary. Explain your answer thoroughly.arrow_forwardDraw the product of each reaction. If there are multiple products, draw only the major product. Explain your answer thoroughly.arrow_forwardIdentify the type of bond in the following disaccharides. Number your carbons to show work. Explain your answer thoroughly. Draw the number of carbons also.arrow_forward
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON