Concept explainers
To determine: The sequences of the mature RNA.
Concept introduction: The sequence of the three mRNA
Given: The sequence of the sense strand of a mammalian gene is as follows:
TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT
Assume that: The transcription initiates at a G, which is approximately 25bp downstream of the TATAATA sequence, in which each 5′ splice site has the sequence AG/GUAAGU, and that each 3′ splice site has the sequence CAG/G, where / marks the location of the splice.
To determine: The sequences of encoded protein.
Concept introduction: The sequence of the three mRNA nucleotides that codes for the amino acids during the translation process is called codon. Three nucleotides constitute a codon that codes for the single amino acid. The codon where the translation process initiates is the start codon, which is usually AUG that codes for methionine. The stop codon terminates the translation process. The stop codons are UAA, UGA, and UAG.
Given: The sequence of the sense strand of a mammalian gene is as follows:
TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT
Assume that: The transcription initiates at a G, which is approximately 25bp downstream of the TATAATA sequence, in which each 5′ splice site has the sequence AG/GUAAGU, and that each 3′ splice site has the sequence CAG/G, where / marks the location of the splice.
Trending nowThis is a popular solution!
Chapter 27 Solutions
FUNDAMENTALS OF BIOCHEMISTRY - LL FD
- Calculate the number of ATP produced from oxidation of 1 molecule of glucosearrow_forwardExample 1: 1. Suppose an enzyme (MW = 5,000 g/mole) has a concentration of 0.05 mg/L. If the kcat is 1 x 10 s, what is the theoretical maximum reaction velocity for the enzyme? A) 1050 µM/s. B) 100 µM/s. C) 150 μM/s. D) 105 μM/s.arrow_forwardIn 1956, E. P. Kennedy and S. B. Weiss published their study of membrane lipid phosphatidylcholine (lecithin) synthesis in rat liver. Their hypothesis was that phosphocholine joined with some cellular component to yield lecithin. In an earlier experiment, incubating 32 P-labeled phosphocholine at physiological temperature (37 °C) with broken cells from rat liver yielded labeled lecithin. This became their assay for the enzymes involved in lecithin synthesis. Determine the optimal pH for this enzyme and characterize the enzyme activity at different pH values. -O-P-O-CH2-CH₁₂-N(CH3)3 Phosphocholine H₂C-O-C-R HC-O-C-R2 + + + Cell fraction + ? HC-O-P-O-CH₁₂-CH₂-N(CH), O Phosphatidylcholine The researchers then centrifuged the broken cell preparation to separate the membranes from the soluble proteins. They tested three preparations: whole extract, membranes, and soluble proteins. Table 1 summarizes the results. Table 1: Cell fraction requirement for incorporation of 32p-phosphocholine into…arrow_forward
- Researchers isolated an unknown substance, X, from rabbit muscle. They determined its structure from the following observations and experiments. (a) Qualitative analysis showed that X was composed entirely of C, H, and O. A weighed sample of X was completely oxidized and the H2O and CO2 produced were measured. This quantitative analysis revealed that X contained 40.00% C, 6.71% H, and 53.29% O by weight. (b) The molecular mass of X, as determined by mass spectrometry, was 90.00 atomic mass units (u). (c) Infrared spectroscopy showed that X contained one double bond. (d) X dissolved readily in water, and the solution demonstrated optical activity when tested in a polarimeter. (e) The aqueous solution of X is acidic. What is the empirical formula of X?arrow_forwardShow work. don't give Ai generated solution....give correct solutionarrow_forwardBiochemistry What is the process of "transamination" in either the muscles or the liver, that involves keto acid or glutamic acid? Please explain how the steps work. Thank you!arrow_forward
- Biochemistry Please help. Thank you What is the importance of glutamic acid in the metabolism of nitrogen from amino acids? (we know therole; it’s used to remove the nitrogen from amino acids so that the remaining carbon skeleton can bebroken down by the “usual” pathways, but what is the important, unique role that only glutamicacid/glutamate can do?)arrow_forwardBiochemistry Please help. Thank you When carbamyl phosphate is joined to L-ornathine, where does the energy for the reaction come from?arrow_forwardBiochemistry Question Please help. Thank you What is the function of glutamate dehydrogenase?arrow_forward
- Biochemistry Question Please help. Thank you How and why does a high protein diet affect the enzymes of the urea cycle?arrow_forwardBiochemistry What is the importance of the glucose-alanine cycle?arrow_forwardBiochemistry Assuming 2.5 molecules of ATP per oxidation of NADH/(H+) and 1.5molecules of ATP per oxidation of FADH2, how many ATP are produced per molecule of pyruvate? Please help. Thank youarrow_forward
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON