The forces responsible for holding the four α helices together in the bundled structure. Introduction : Some scientists utilized various aspects of genetic code to generate protein sequences with defined hydrophobic and hydrophilic residues. Through this they explored the factors that affect structure of protein. They generated a set of proteins with simple four-helix bundle structure which were connected by random coils.

Question

Want to see more full solutions like this?

Answer 1

Question

Chapter 27, Problem 22DAP

(a)

Summary Introduction

To explain: The forces responsible for holding the four α helices together in the bundled structure.

Introduction:

Some scientists utilized various aspects of genetic code to generate protein sequences with defined hydrophobic and hydrophilic residues. Through this they explored the factors that affect structure of protein. They generated a set of proteins with simple four-helix bundle structure which were connected by random coils.

(a)

Expert Solution

Explanation of Solution

Explanation:

Since the scientists utilized defined patterns of hydrophobic and hydrophilic residues, the hydrophobic chains in the four α-helices face each other. They will form hydrophobic interaction. Non-covalent interactions such as hydrophobic interactions and weak Van der Waals force hold together four α-helices.

(b)

Summary Introduction

To number: The R groups which extend from right side and the groups which extend from left side in Fig. 4-4a.

Introduction: Refer Fig. 4-4a: “Models of the α-helix, showing different aspects of its structure” in the textbook. There is a central gray rod. Four of the purple spheres extend from left side and six of R groups extend from right.

(b)

Expert Solution

Explanation of Solution

Explanation:

The numbering of extended R groups starts from top to bottom. The first extending R group is towards the right side, and the second group also extends to the right side. Third R group extends to the left side. Fourth and fifth group extends toward the right side. Seventh group extends from left side. Eighth and ninth group extends from right side and lastly, the tenth group extends from left side. So R group 1, 2, 4, 5, 8, and 9 extends to right side and R group 3, 6, 7, and 10 extends to the left side.

(c)

Summary Introduction

To give: A sequence of 10 amino acids that could form an amphipathic helix with left side hydrophilic and right side hydrophobic.

Introduction:

Proteins are macromolecules which are comprised of amino acids linked together by peptide or amide bonds. Amino acids are classified into various groups depending on the chemical properties. Some of the amino acids are hydrophilic and some of the amino acids are hydrophobic.

(c)

Expert Solution

Explanation of Solution

Explanation:

Some of the hydrophobic amino acids are alanine (Ala), valine (Val), isoleucine (Ile), leucine (Leu), methionine (Met), phenylalanine (Phe), tyrosine (Tyr), and tryptophan (Trp). Some of the hydrophilic amino acids are lysine (Lys), arginine (Arg), histidine (His), aspartate (Asp), serine (Ser), threonine (Thr), glutamate (Glu), asparagine (Asn), and glutamine (Gln). These amino acids can form an amphipathic helix. Thus, one of the possible sequences can be:

$N-Phe-Ile-Glu-Val-Met-Asn-Ser-Ala-Phe-Gln-C$

(d)

Summary Introduction

To give: One possible double-stranded DNA (deoxyribonucleic acid) sequence of amino acid sequence of $N-Phe-Ile-Glu-Val-Met-Asn-Ser-Ala-Phe-Gln-C$ .

Introduction:

Each amino acid is coded by $3$ nucleotide bases. There are several amino acids which are coded by more than one codon. Such amino acids are known as degenerate amino acids.

(d)

Expert Solution

Explanation of Solution

Explanation:

The sequence of messenger ribonucleic acid (mRNA) is similar to the non-template strand and is complementary to template stand. During transcription, template strand is used as base.

So, one of the possible sequence of mRNA can be

$5′−UUUAUUGAAGUAAUGAAUAGUGCAUUCCAG−3′$

The sequence of the non-template strand of the DNA will be similar to them RNA. The sequence of non-template strand will be as follows:

$5′−TTTATTGAAGTAATGAATAGTGCATTCCAG−3′$

The sequence of the template strand will be complementary to mRNA. The sequence of template strand will be as follows:

$3′−AATAACTTCATTACTTATCACGTAAGGTC−5′$ .

(e)

Summary Introduction

To explain: The amino acids that can be coded by NTN triplet and whether all amino acids in this set are hydrophobic and include all hydrophobic amino acids.

Introduction:

A scientist designed proteins with random sequences and placed hydrophobic and hydrophilic amino acid in a controlled manner. The researchers began with NTN to design a DNA sequence.

(e)

Expert Solution

Explanation of Solution

Explanation:

To encode hydrophobic sequence of amino acids they used NTN codon. In NTN, N refers to any nucleotide base and T refers to Thymine. The codon with uracil at the second position codes for phenylalanine, leucine, isoleucine, methionine, and valine. All of these are hydrophobic amino acids. However, there are certain other hydrophobic amino acids such as tryptophan, alanine, glycine, and proline that are missing.

(f)

Summary Introduction

To explain: The amino acids coded by NAN triplet, whether all amino acids in this set would be polar and include all polar amino acids.

Introduction:

A scientist designed proteins with random sequences and placed hydrophobic and hydrophilic amino acid in a controlled manner. The researchers began with NTN to design a DNA sequence. Then they used NAN to design a DNA sequence.

(f)

Expert Solution

Explanation of Solution

Explanation:

To encode polar sequence of amino acids they used NAN codon. In NAN, N refers to any nucleotide base and A refers to Adenine. The codon with Adenine at the second position codes for tyrosine, histidine, glutamine, asparagines, lysine, aspartate, and glutamate. All of these are polar amino acids. However, there are certain other polar amino acids which are left such as arginine, serine, and threonine are missing.

(g)

Summary Introduction

To explain: The reason why T is left out of mixture while creating NAN codons.

Introduction:

To encode polar sequence of amino acids some scientists used the NAN codon. In NAN, N refers to any nucleotide base and A refers to Adenine. This codon was used by certain scientists.

(g)

Expert Solution

Explanation of Solution

Explanation:

In creating NAN codons, it was necessary to keep T out of the reaction mixture. As a consequence of absence of T in the reaction mixture, TAA and TAG will not form. Both of these codons are stop codons.

(h)

Summary Introduction

To explain: The reason behind the failure of grossly misfolded protein to produce a band of expected molecular weight on electrophoresis.

Introduction:

Some scientists cloned the random DNA sequences and selected 48that produced accurate patterning of hydrophobic and hydrophilic amino acids. To test whether the proteins folded accurately they screened for proteins with expected molecular weight on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

(h)

Expert Solution

Explanation of Solution

Explanation:

The proteins which are misfolded or partially folded are degraded by ubiquitin-proteasome complex. The functional proteins are folded properly. So as a consequence of degradation of misfolded proteins, they will not give a separate band on electrophoresis.

(i)

Summary Introduction

To explain: The reason why all random-sequence proteins that passed initial screening test produce four-helix structures.

Introduction:

Some scientists cloned the random DNA sequences and selected 48 that produced accurate patterning of hydrophobic and hydrophilic amino acids. To test whether the proteins folded accurately they screened for proteins with expected molecular weight on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

(i)

Expert Solution

Explanation of Solution

Explanation:

There are certain specific criteria for production of four-helix structures. Even a single amino acid difference will result in different folding patterns of whole peptide. Four-helix peptide is holded together by Van der Waals forces and hydrophobic interactions. Steric hindrance might be another reason behind not folding into four-helix peptide.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

Compare and contrast primary and secondary active transport mechanisms in terms of energy utilisation and efficiency. Provide examples of each and discuss their physiological significance in maintaining ionic balance and nutrient uptake. Rubric Understanding the key concepts (clearly and accurately explains primary and secondary active transport mechanisms, showing a deep understanding of their roles) Energy utilisation analysis ( thoroughly compares energy utilisation in primary and secondary transport with specific and relevant examples Efficiency discussion Use of examples (provides relevant and accurate examples (e.g sodium potassium pump, SGLT1) with clear links to physiological significance. Clarity and structure (presents ideas logically and cohesively with clear organisation and smooth transition between sections)

9. Which one of the compounds below is the major organic product obtained from the following reaction sequence, starting with ethyl acetoacetate? 요요. 1. NaOCH2CH3 CH3CH2OH 1. NaOH, H₂O 2. H3O+ 3. A OCH2CH3 2. ethyl acetoacetate ii A 3. H3O+ OH B C D E

7. Only one of the following ketones cannot be made via an acetoacetic ester synthesis. Which one is it? Ph کہ A B C D E

Answer 2

Question

Chapter 27, Problem 22DAP

(a)

Summary Introduction

To explain: The forces responsible for holding the four α helices together in the bundled structure.

Introduction:

Some scientists utilized various aspects of genetic code to generate protein sequences with defined hydrophobic and hydrophilic residues. Through this they explored the factors that affect structure of protein. They generated a set of proteins with simple four-helix bundle structure which were connected by random coils.

(a)

Expert Solution

Explanation of Solution

Explanation:

Since the scientists utilized defined patterns of hydrophobic and hydrophilic residues, the hydrophobic chains in the four α-helices face each other. They will form hydrophobic interaction. Non-covalent interactions such as hydrophobic interactions and weak Van der Waals force hold together four α-helices.

(b)

Summary Introduction

To number: The R groups which extend from right side and the groups which extend from left side in Fig. 4-4a.

Introduction: Refer Fig. 4-4a: “Models of the α-helix, showing different aspects of its structure” in the textbook. There is a central gray rod. Four of the purple spheres extend from left side and six of R groups extend from right.

(b)

Expert Solution

Explanation of Solution

Explanation:

The numbering of extended R groups starts from top to bottom. The first extending R group is towards the right side, and the second group also extends to the right side. Third R group extends to the left side. Fourth and fifth group extends toward the right side. Seventh group extends from left side. Eighth and ninth group extends from right side and lastly, the tenth group extends from left side. So R group 1, 2, 4, 5, 8, and 9 extends to right side and R group 3, 6, 7, and 10 extends to the left side.

(c)

Summary Introduction

To give: A sequence of 10 amino acids that could form an amphipathic helix with left side hydrophilic and right side hydrophobic.

Introduction:

Proteins are macromolecules which are comprised of amino acids linked together by peptide or amide bonds. Amino acids are classified into various groups depending on the chemical properties. Some of the amino acids are hydrophilic and some of the amino acids are hydrophobic.

(c)

Expert Solution

Explanation of Solution

Explanation:

Some of the hydrophobic amino acids are alanine (Ala), valine (Val), isoleucine (Ile), leucine (Leu), methionine (Met), phenylalanine (Phe), tyrosine (Tyr), and tryptophan (Trp). Some of the hydrophilic amino acids are lysine (Lys), arginine (Arg), histidine (His), aspartate (Asp), serine (Ser), threonine (Thr), glutamate (Glu), asparagine (Asn), and glutamine (Gln). These amino acids can form an amphipathic helix. Thus, one of the possible sequences can be:

$N-Phe-Ile-Glu-Val-Met-Asn-Ser-Ala-Phe-Gln-C$

(d)

Summary Introduction

To give: One possible double-stranded DNA (deoxyribonucleic acid) sequence of amino acid sequence of $N-Phe-Ile-Glu-Val-Met-Asn-Ser-Ala-Phe-Gln-C$ .

Introduction:

Each amino acid is coded by $3$ nucleotide bases. There are several amino acids which are coded by more than one codon. Such amino acids are known as degenerate amino acids.

(d)

Expert Solution

Explanation of Solution

Explanation:

The sequence of messenger ribonucleic acid (mRNA) is similar to the non-template strand and is complementary to template stand. During transcription, template strand is used as base.

So, one of the possible sequence of mRNA can be

$5′−UUUAUUGAAGUAAUGAAUAGUGCAUUCCAG−3′$

The sequence of the non-template strand of the DNA will be similar to them RNA. The sequence of non-template strand will be as follows:

$5′−TTTATTGAAGTAATGAATAGTGCATTCCAG−3′$

The sequence of the template strand will be complementary to mRNA. The sequence of template strand will be as follows:

$3′−AATAACTTCATTACTTATCACGTAAGGTC−5′$ .

(e)

Summary Introduction

To explain: The amino acids that can be coded by NTN triplet and whether all amino acids in this set are hydrophobic and include all hydrophobic amino acids.

Introduction:

A scientist designed proteins with random sequences and placed hydrophobic and hydrophilic amino acid in a controlled manner. The researchers began with NTN to design a DNA sequence.

(e)

Expert Solution

Explanation of Solution

Explanation:

To encode hydrophobic sequence of amino acids they used NTN codon. In NTN, N refers to any nucleotide base and T refers to Thymine. The codon with uracil at the second position codes for phenylalanine, leucine, isoleucine, methionine, and valine. All of these are hydrophobic amino acids. However, there are certain other hydrophobic amino acids such as tryptophan, alanine, glycine, and proline that are missing.

(f)

Summary Introduction

To explain: The amino acids coded by NAN triplet, whether all amino acids in this set would be polar and include all polar amino acids.

Introduction:

A scientist designed proteins with random sequences and placed hydrophobic and hydrophilic amino acid in a controlled manner. The researchers began with NTN to design a DNA sequence. Then they used NAN to design a DNA sequence.

(f)

Expert Solution

Explanation of Solution

Explanation:

To encode polar sequence of amino acids they used NAN codon. In NAN, N refers to any nucleotide base and A refers to Adenine. The codon with Adenine at the second position codes for tyrosine, histidine, glutamine, asparagines, lysine, aspartate, and glutamate. All of these are polar amino acids. However, there are certain other polar amino acids which are left such as arginine, serine, and threonine are missing.

(g)

Summary Introduction

To explain: The reason why T is left out of mixture while creating NAN codons.

Introduction:

To encode polar sequence of amino acids some scientists used the NAN codon. In NAN, N refers to any nucleotide base and A refers to Adenine. This codon was used by certain scientists.

(g)

Expert Solution

Explanation of Solution

Explanation:

In creating NAN codons, it was necessary to keep T out of the reaction mixture. As a consequence of absence of T in the reaction mixture, TAA and TAG will not form. Both of these codons are stop codons.

(h)

Summary Introduction

To explain: The reason behind the failure of grossly misfolded protein to produce a band of expected molecular weight on electrophoresis.

Introduction:

Some scientists cloned the random DNA sequences and selected 48that produced accurate patterning of hydrophobic and hydrophilic amino acids. To test whether the proteins folded accurately they screened for proteins with expected molecular weight on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

(h)

Expert Solution

Explanation of Solution

Explanation:

The proteins which are misfolded or partially folded are degraded by ubiquitin-proteasome complex. The functional proteins are folded properly. So as a consequence of degradation of misfolded proteins, they will not give a separate band on electrophoresis.

(i)

Summary Introduction

To explain: The reason why all random-sequence proteins that passed initial screening test produce four-helix structures.

Introduction:

Some scientists cloned the random DNA sequences and selected 48 that produced accurate patterning of hydrophobic and hydrophilic amino acids. To test whether the proteins folded accurately they screened for proteins with expected molecular weight on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

(i)

Expert Solution

Explanation of Solution

Explanation:

There are certain specific criteria for production of four-helix structures. Even a single amino acid difference will result in different folding patterns of whole peptide. Four-helix peptide is holded together by Van der Waals forces and hydrophobic interactions. Steric hindrance might be another reason behind not folding into four-helix peptide.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Question

Chapter 27, Problem 22DAP

(a)

Summary Introduction

To explain: The forces responsible for holding the four α helices together in the bundled structure.

Introduction:

Some scientists utilized various aspects of genetic code to generate protein sequences with defined hydrophobic and hydrophilic residues. Through this they explored the factors that affect structure of protein. They generated a set of proteins with simple four-helix bundle structure which were connected by random coils.

(a)

Expert Solution

Explanation of Solution

Explanation:

Since the scientists utilized defined patterns of hydrophobic and hydrophilic residues, the hydrophobic chains in the four α-helices face each other. They will form hydrophobic interaction. Non-covalent interactions such as hydrophobic interactions and weak Van der Waals force hold together four α-helices.

(b)

Summary Introduction

To number: The R groups which extend from right side and the groups which extend from left side in Fig. 4-4a.

Introduction: Refer Fig. 4-4a: “Models of the α-helix, showing different aspects of its structure” in the textbook. There is a central gray rod. Four of the purple spheres extend from left side and six of R groups extend from right.

(b)

Expert Solution

Explanation of Solution

Explanation:

The numbering of extended R groups starts from top to bottom. The first extending R group is towards the right side, and the second group also extends to the right side. Third R group extends to the left side. Fourth and fifth group extends toward the right side. Seventh group extends from left side. Eighth and ninth group extends from right side and lastly, the tenth group extends from left side. So R group 1, 2, 4, 5, 8, and 9 extends to right side and R group 3, 6, 7, and 10 extends to the left side.

(c)

Summary Introduction

To give: A sequence of 10 amino acids that could form an amphipathic helix with left side hydrophilic and right side hydrophobic.

Introduction:

Proteins are macromolecules which are comprised of amino acids linked together by peptide or amide bonds. Amino acids are classified into various groups depending on the chemical properties. Some of the amino acids are hydrophilic and some of the amino acids are hydrophobic.

(c)

Expert Solution

Explanation of Solution

Explanation:

Some of the hydrophobic amino acids are alanine (Ala), valine (Val), isoleucine (Ile), leucine (Leu), methionine (Met), phenylalanine (Phe), tyrosine (Tyr), and tryptophan (Trp). Some of the hydrophilic amino acids are lysine (Lys), arginine (Arg), histidine (His), aspartate (Asp), serine (Ser), threonine (Thr), glutamate (Glu), asparagine (Asn), and glutamine (Gln). These amino acids can form an amphipathic helix. Thus, one of the possible sequences can be:

$N-Phe-Ile-Glu-Val-Met-Asn-Ser-Ala-Phe-Gln-C$

(d)

Summary Introduction

To give: One possible double-stranded DNA (deoxyribonucleic acid) sequence of amino acid sequence of $N-Phe-Ile-Glu-Val-Met-Asn-Ser-Ala-Phe-Gln-C$ .

Introduction:

Each amino acid is coded by $3$ nucleotide bases. There are several amino acids which are coded by more than one codon. Such amino acids are known as degenerate amino acids.

(d)

Expert Solution

Explanation of Solution

Explanation:

The sequence of messenger ribonucleic acid (mRNA) is similar to the non-template strand and is complementary to template stand. During transcription, template strand is used as base.

So, one of the possible sequence of mRNA can be

$5′−UUUAUUGAAGUAAUGAAUAGUGCAUUCCAG−3′$

The sequence of the non-template strand of the DNA will be similar to them RNA. The sequence of non-template strand will be as follows:

$5′−TTTATTGAAGTAATGAATAGTGCATTCCAG−3′$

The sequence of the template strand will be complementary to mRNA. The sequence of template strand will be as follows:

$3′−AATAACTTCATTACTTATCACGTAAGGTC−5′$ .

(e)

Summary Introduction

To explain: The amino acids that can be coded by NTN triplet and whether all amino acids in this set are hydrophobic and include all hydrophobic amino acids.

Introduction:

A scientist designed proteins with random sequences and placed hydrophobic and hydrophilic amino acid in a controlled manner. The researchers began with NTN to design a DNA sequence.

(e)

Expert Solution

Explanation of Solution

Explanation:

To encode hydrophobic sequence of amino acids they used NTN codon. In NTN, N refers to any nucleotide base and T refers to Thymine. The codon with uracil at the second position codes for phenylalanine, leucine, isoleucine, methionine, and valine. All of these are hydrophobic amino acids. However, there are certain other hydrophobic amino acids such as tryptophan, alanine, glycine, and proline that are missing.

(f)

Summary Introduction

To explain: The amino acids coded by NAN triplet, whether all amino acids in this set would be polar and include all polar amino acids.

Introduction:

A scientist designed proteins with random sequences and placed hydrophobic and hydrophilic amino acid in a controlled manner. The researchers began with NTN to design a DNA sequence. Then they used NAN to design a DNA sequence.

(f)

Expert Solution

Explanation of Solution

Explanation:

To encode polar sequence of amino acids they used NAN codon. In NAN, N refers to any nucleotide base and A refers to Adenine. The codon with Adenine at the second position codes for tyrosine, histidine, glutamine, asparagines, lysine, aspartate, and glutamate. All of these are polar amino acids. However, there are certain other polar amino acids which are left such as arginine, serine, and threonine are missing.

(g)

Summary Introduction

To explain: The reason why T is left out of mixture while creating NAN codons.

Introduction:

To encode polar sequence of amino acids some scientists used the NAN codon. In NAN, N refers to any nucleotide base and A refers to Adenine. This codon was used by certain scientists.

(g)

Expert Solution

Explanation of Solution

Explanation:

In creating NAN codons, it was necessary to keep T out of the reaction mixture. As a consequence of absence of T in the reaction mixture, TAA and TAG will not form. Both of these codons are stop codons.

(h)

Summary Introduction

To explain: The reason behind the failure of grossly misfolded protein to produce a band of expected molecular weight on electrophoresis.

Introduction:

Some scientists cloned the random DNA sequences and selected 48that produced accurate patterning of hydrophobic and hydrophilic amino acids. To test whether the proteins folded accurately they screened for proteins with expected molecular weight on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

(h)

Expert Solution

Explanation of Solution

Explanation:

The proteins which are misfolded or partially folded are degraded by ubiquitin-proteasome complex. The functional proteins are folded properly. So as a consequence of degradation of misfolded proteins, they will not give a separate band on electrophoresis.

(i)

Summary Introduction

To explain: The reason why all random-sequence proteins that passed initial screening test produce four-helix structures.

Introduction:

Some scientists cloned the random DNA sequences and selected 48 that produced accurate patterning of hydrophobic and hydrophilic amino acids. To test whether the proteins folded accurately they screened for proteins with expected molecular weight on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

(i)

Expert Solution

Explanation of Solution

Explanation:

There are certain specific criteria for production of four-helix structures. Even a single amino acid difference will result in different folding patterns of whole peptide. Four-helix peptide is holded together by Van der Waals forces and hydrophobic interactions. Steric hindrance might be another reason behind not folding into four-helix peptide.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Question

Chapter 27, Problem 22DAP

(a)

Summary Introduction

To explain: The forces responsible for holding the four α helices together in the bundled structure.

Introduction:

Some scientists utilized various aspects of genetic code to generate protein sequences with defined hydrophobic and hydrophilic residues. Through this they explored the factors that affect structure of protein. They generated a set of proteins with simple four-helix bundle structure which were connected by random coils.

(a)

Expert Solution

Explanation of Solution

Explanation:

Since the scientists utilized defined patterns of hydrophobic and hydrophilic residues, the hydrophobic chains in the four α-helices face each other. They will form hydrophobic interaction. Non-covalent interactions such as hydrophobic interactions and weak Van der Waals force hold together four α-helices.

(b)

Summary Introduction

To number: The R groups which extend from right side and the groups which extend from left side in Fig. 4-4a.

Introduction: Refer Fig. 4-4a: “Models of the α-helix, showing different aspects of its structure” in the textbook. There is a central gray rod. Four of the purple spheres extend from left side and six of R groups extend from right.

(b)

Expert Solution

Explanation of Solution

Explanation:

The numbering of extended R groups starts from top to bottom. The first extending R group is towards the right side, and the second group also extends to the right side. Third R group extends to the left side. Fourth and fifth group extends toward the right side. Seventh group extends from left side. Eighth and ninth group extends from right side and lastly, the tenth group extends from left side. So R group 1, 2, 4, 5, 8, and 9 extends to right side and R group 3, 6, 7, and 10 extends to the left side.

(c)

Summary Introduction

To give: A sequence of 10 amino acids that could form an amphipathic helix with left side hydrophilic and right side hydrophobic.

Introduction:

Proteins are macromolecules which are comprised of amino acids linked together by peptide or amide bonds. Amino acids are classified into various groups depending on the chemical properties. Some of the amino acids are hydrophilic and some of the amino acids are hydrophobic.

(c)

Expert Solution

Explanation of Solution

Explanation:

Some of the hydrophobic amino acids are alanine (Ala), valine (Val), isoleucine (Ile), leucine (Leu), methionine (Met), phenylalanine (Phe), tyrosine (Tyr), and tryptophan (Trp). Some of the hydrophilic amino acids are lysine (Lys), arginine (Arg), histidine (His), aspartate (Asp), serine (Ser), threonine (Thr), glutamate (Glu), asparagine (Asn), and glutamine (Gln). These amino acids can form an amphipathic helix. Thus, one of the possible sequences can be:

$N-Phe-Ile-Glu-Val-Met-Asn-Ser-Ala-Phe-Gln-C$

(d)

Summary Introduction

To give: One possible double-stranded DNA (deoxyribonucleic acid) sequence of amino acid sequence of $N-Phe-Ile-Glu-Val-Met-Asn-Ser-Ala-Phe-Gln-C$ .

Introduction:

Each amino acid is coded by $3$ nucleotide bases. There are several amino acids which are coded by more than one codon. Such amino acids are known as degenerate amino acids.

(d)

Expert Solution

Explanation of Solution

Explanation:

The sequence of messenger ribonucleic acid (mRNA) is similar to the non-template strand and is complementary to template stand. During transcription, template strand is used as base.

So, one of the possible sequence of mRNA can be

$5′−UUUAUUGAAGUAAUGAAUAGUGCAUUCCAG−3′$

The sequence of the non-template strand of the DNA will be similar to them RNA. The sequence of non-template strand will be as follows:

$5′−TTTATTGAAGTAATGAATAGTGCATTCCAG−3′$

The sequence of the template strand will be complementary to mRNA. The sequence of template strand will be as follows:

$3′−AATAACTTCATTACTTATCACGTAAGGTC−5′$ .

(e)

Summary Introduction

To explain: The amino acids that can be coded by NTN triplet and whether all amino acids in this set are hydrophobic and include all hydrophobic amino acids.

Introduction:

A scientist designed proteins with random sequences and placed hydrophobic and hydrophilic amino acid in a controlled manner. The researchers began with NTN to design a DNA sequence.

(e)

Expert Solution

Explanation of Solution

Explanation:

To encode hydrophobic sequence of amino acids they used NTN codon. In NTN, N refers to any nucleotide base and T refers to Thymine. The codon with uracil at the second position codes for phenylalanine, leucine, isoleucine, methionine, and valine. All of these are hydrophobic amino acids. However, there are certain other hydrophobic amino acids such as tryptophan, alanine, glycine, and proline that are missing.

(f)

Summary Introduction

To explain: The amino acids coded by NAN triplet, whether all amino acids in this set would be polar and include all polar amino acids.

Introduction:

A scientist designed proteins with random sequences and placed hydrophobic and hydrophilic amino acid in a controlled manner. The researchers began with NTN to design a DNA sequence. Then they used NAN to design a DNA sequence.

(f)

Expert Solution

Explanation of Solution

Explanation:

To encode polar sequence of amino acids they used NAN codon. In NAN, N refers to any nucleotide base and A refers to Adenine. The codon with Adenine at the second position codes for tyrosine, histidine, glutamine, asparagines, lysine, aspartate, and glutamate. All of these are polar amino acids. However, there are certain other polar amino acids which are left such as arginine, serine, and threonine are missing.

(g)

Summary Introduction

To explain: The reason why T is left out of mixture while creating NAN codons.

Introduction:

To encode polar sequence of amino acids some scientists used the NAN codon. In NAN, N refers to any nucleotide base and A refers to Adenine. This codon was used by certain scientists.

(g)

Expert Solution

Explanation of Solution

Explanation:

In creating NAN codons, it was necessary to keep T out of the reaction mixture. As a consequence of absence of T in the reaction mixture, TAA and TAG will not form. Both of these codons are stop codons.

(h)

Summary Introduction

To explain: The reason behind the failure of grossly misfolded protein to produce a band of expected molecular weight on electrophoresis.

Introduction:

Some scientists cloned the random DNA sequences and selected 48that produced accurate patterning of hydrophobic and hydrophilic amino acids. To test whether the proteins folded accurately they screened for proteins with expected molecular weight on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

(h)

Expert Solution

Explanation of Solution

Explanation:

The proteins which are misfolded or partially folded are degraded by ubiquitin-proteasome complex. The functional proteins are folded properly. So as a consequence of degradation of misfolded proteins, they will not give a separate band on electrophoresis.

(i)

Summary Introduction

To explain: The reason why all random-sequence proteins that passed initial screening test produce four-helix structures.

Introduction:

Some scientists cloned the random DNA sequences and selected 48 that produced accurate patterning of hydrophobic and hydrophilic amino acids. To test whether the proteins folded accurately they screened for proteins with expected molecular weight on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

(i)

Expert Solution

Explanation of Solution

Explanation:

There are certain specific criteria for production of four-helix structures. Even a single amino acid difference will result in different folding patterns of whole peptide. Four-helix peptide is holded together by Van der Waals forces and hydrophobic interactions. Steric hindrance might be another reason behind not folding into four-helix peptide.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Chapter 27, Problem 22DAP

(a)

Summary Introduction

To explain: The forces responsible for holding the four α helices together in the bundled structure.

Introduction:

Some scientists utilized various aspects of genetic code to generate protein sequences with defined hydrophobic and hydrophilic residues. Through this they explored the factors that affect structure of protein. They generated a set of proteins with simple four-helix bundle structure which were connected by random coils.

(a)

Expert Solution

Explanation of Solution

Explanation:

Since the scientists utilized defined patterns of hydrophobic and hydrophilic residues, the hydrophobic chains in the four α-helices face each other. They will form hydrophobic interaction. Non-covalent interactions such as hydrophobic interactions and weak Van der Waals force hold together four α-helices.

(b)

Summary Introduction

To number: The R groups which extend from right side and the groups which extend from left side in Fig. 4-4a.

Introduction: Refer Fig. 4-4a: “Models of the α-helix, showing different aspects of its structure” in the textbook. There is a central gray rod. Four of the purple spheres extend from left side and six of R groups extend from right.

(b)

Expert Solution

Explanation of Solution

Explanation:

The numbering of extended R groups starts from top to bottom. The first extending R group is towards the right side, and the second group also extends to the right side. Third R group extends to the left side. Fourth and fifth group extends toward the right side. Seventh group extends from left side. Eighth and ninth group extends from right side and lastly, the tenth group extends from left side. So R group 1, 2, 4, 5, 8, and 9 extends to right side and R group 3, 6, 7, and 10 extends to the left side.

(c)

Summary Introduction

To give: A sequence of 10 amino acids that could form an amphipathic helix with left side hydrophilic and right side hydrophobic.

Introduction:

Proteins are macromolecules which are comprised of amino acids linked together by peptide or amide bonds. Amino acids are classified into various groups depending on the chemical properties. Some of the amino acids are hydrophilic and some of the amino acids are hydrophobic.

(c)

Expert Solution

Explanation of Solution

Explanation:

Some of the hydrophobic amino acids are alanine (Ala), valine (Val), isoleucine (Ile), leucine (Leu), methionine (Met), phenylalanine (Phe), tyrosine (Tyr), and tryptophan (Trp). Some of the hydrophilic amino acids are lysine (Lys), arginine (Arg), histidine (His), aspartate (Asp), serine (Ser), threonine (Thr), glutamate (Glu), asparagine (Asn), and glutamine (Gln). These amino acids can form an amphipathic helix. Thus, one of the possible sequences can be:

$N-Phe-Ile-Glu-Val-Met-Asn-Ser-Ala-Phe-Gln-C$

(d)

Summary Introduction

To give: One possible double-stranded DNA (deoxyribonucleic acid) sequence of amino acid sequence of $N-Phe-Ile-Glu-Val-Met-Asn-Ser-Ala-Phe-Gln-C$ .

Introduction:

Each amino acid is coded by $3$ nucleotide bases. There are several amino acids which are coded by more than one codon. Such amino acids are known as degenerate amino acids.

(d)

Expert Solution

Explanation of Solution

Explanation:

The sequence of messenger ribonucleic acid (mRNA) is similar to the non-template strand and is complementary to template stand. During transcription, template strand is used as base.

So, one of the possible sequence of mRNA can be

$5′−UUUAUUGAAGUAAUGAAUAGUGCAUUCCAG−3′$

The sequence of the non-template strand of the DNA will be similar to them RNA. The sequence of non-template strand will be as follows:

$5′−TTTATTGAAGTAATGAATAGTGCATTCCAG−3′$

The sequence of the template strand will be complementary to mRNA. The sequence of template strand will be as follows:

$3′−AATAACTTCATTACTTATCACGTAAGGTC−5′$ .

(e)

Summary Introduction

To explain: The amino acids that can be coded by NTN triplet and whether all amino acids in this set are hydrophobic and include all hydrophobic amino acids.

Introduction:

A scientist designed proteins with random sequences and placed hydrophobic and hydrophilic amino acid in a controlled manner. The researchers began with NTN to design a DNA sequence.

(e)

Expert Solution

Explanation of Solution

Explanation:

To encode hydrophobic sequence of amino acids they used NTN codon. In NTN, N refers to any nucleotide base and T refers to Thymine. The codon with uracil at the second position codes for phenylalanine, leucine, isoleucine, methionine, and valine. All of these are hydrophobic amino acids. However, there are certain other hydrophobic amino acids such as tryptophan, alanine, glycine, and proline that are missing.

(f)

Summary Introduction

To explain: The amino acids coded by NAN triplet, whether all amino acids in this set would be polar and include all polar amino acids.

Introduction:

A scientist designed proteins with random sequences and placed hydrophobic and hydrophilic amino acid in a controlled manner. The researchers began with NTN to design a DNA sequence. Then they used NAN to design a DNA sequence.

(f)

Expert Solution

Explanation of Solution

Explanation:

To encode polar sequence of amino acids they used NAN codon. In NAN, N refers to any nucleotide base and A refers to Adenine. The codon with Adenine at the second position codes for tyrosine, histidine, glutamine, asparagines, lysine, aspartate, and glutamate. All of these are polar amino acids. However, there are certain other polar amino acids which are left such as arginine, serine, and threonine are missing.

(g)

Summary Introduction

To explain: The reason why T is left out of mixture while creating NAN codons.

Introduction:

To encode polar sequence of amino acids some scientists used the NAN codon. In NAN, N refers to any nucleotide base and A refers to Adenine. This codon was used by certain scientists.

(g)

Expert Solution

Explanation of Solution

Explanation:

In creating NAN codons, it was necessary to keep T out of the reaction mixture. As a consequence of absence of T in the reaction mixture, TAA and TAG will not form. Both of these codons are stop codons.

(h)

Summary Introduction

To explain: The reason behind the failure of grossly misfolded protein to produce a band of expected molecular weight on electrophoresis.

Introduction:

Some scientists cloned the random DNA sequences and selected 48that produced accurate patterning of hydrophobic and hydrophilic amino acids. To test whether the proteins folded accurately they screened for proteins with expected molecular weight on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

(h)

Expert Solution

Explanation of Solution

Explanation:

The proteins which are misfolded or partially folded are degraded by ubiquitin-proteasome complex. The functional proteins are folded properly. So as a consequence of degradation of misfolded proteins, they will not give a separate band on electrophoresis.

(i)

Summary Introduction

To explain: The reason why all random-sequence proteins that passed initial screening test produce four-helix structures.

Introduction:

Some scientists cloned the random DNA sequences and selected 48 that produced accurate patterning of hydrophobic and hydrophilic amino acids. To test whether the proteins folded accurately they screened for proteins with expected molecular weight on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

(i)

Expert Solution

Explanation of Solution

Explanation:

There are certain specific criteria for production of four-helix structures. Even a single amino acid difference will result in different folding patterns of whole peptide. Four-helix peptide is holded together by Van der Waals forces and hydrophobic interactions. Steric hindrance might be another reason behind not folding into four-helix peptide.

Answer 6

Chapter 27, Problem 22DAP

(a)

Summary Introduction

To explain: The forces responsible for holding the four α helices together in the bundled structure.

Introduction:

Some scientists utilized various aspects of genetic code to generate protein sequences with defined hydrophobic and hydrophilic residues. Through this they explored the factors that affect structure of protein. They generated a set of proteins with simple four-helix bundle structure which were connected by random coils.

(a)

Expert Solution

Explanation of Solution

Explanation:

Since the scientists utilized defined patterns of hydrophobic and hydrophilic residues, the hydrophobic chains in the four α-helices face each other. They will form hydrophobic interaction. Non-covalent interactions such as hydrophobic interactions and weak Van der Waals force hold together four α-helices.

Answer 7

Chapter 27, Problem 22DAP

(a)

Summary Introduction

To explain: The forces responsible for holding the four α helices together in the bundled structure.

Introduction:

Some scientists utilized various aspects of genetic code to generate protein sequences with defined hydrophobic and hydrophilic residues. Through this they explored the factors that affect structure of protein. They generated a set of proteins with simple four-helix bundle structure which were connected by random coils.

Answer 8

(a)

Expert Solution

Explanation of Solution

Explanation:

Since the scientists utilized defined patterns of hydrophobic and hydrophilic residues, the hydrophobic chains in the four α-helices face each other. They will form hydrophobic interaction. Non-covalent interactions such as hydrophobic interactions and weak Van der Waals force hold together four α-helices.

Answer 9

(a)

Expert Solution

Answer 10

(a)

Expert Solution

Answer 11

Expert Solution

Answer 12

(b)

Summary Introduction

To number: The R groups which extend from right side and the groups which extend from left side in Fig. 4-4a.

Introduction: Refer Fig. 4-4a: “Models of the α-helix, showing different aspects of its structure” in the textbook. There is a central gray rod. Four of the purple spheres extend from left side and six of R groups extend from right.

(b)

Expert Solution

Explanation of Solution

Explanation:

The numbering of extended R groups starts from top to bottom. The first extending R group is towards the right side, and the second group also extends to the right side. Third R group extends to the left side. Fourth and fifth group extends toward the right side. Seventh group extends from left side. Eighth and ninth group extends from right side and lastly, the tenth group extends from left side. So R group 1, 2, 4, 5, 8, and 9 extends to right side and R group 3, 6, 7, and 10 extends to the left side.

Answer 13

(b)

Summary Introduction

To number: The R groups which extend from right side and the groups which extend from left side in Fig. 4-4a.

Introduction: Refer Fig. 4-4a: “Models of the α-helix, showing different aspects of its structure” in the textbook. There is a central gray rod. Four of the purple spheres extend from left side and six of R groups extend from right.

Answer 14

(b)

Expert Solution

Explanation of Solution

Explanation:

The numbering of extended R groups starts from top to bottom. The first extending R group is towards the right side, and the second group also extends to the right side. Third R group extends to the left side. Fourth and fifth group extends toward the right side. Seventh group extends from left side. Eighth and ninth group extends from right side and lastly, the tenth group extends from left side. So R group 1, 2, 4, 5, 8, and 9 extends to right side and R group 3, 6, 7, and 10 extends to the left side.

Answer 15

(b)

Expert Solution

Answer 16

(b)

Expert Solution

Answer 17

Expert Solution

Answer 18

(c)

Summary Introduction

To give: A sequence of 10 amino acids that could form an amphipathic helix with left side hydrophilic and right side hydrophobic.

Introduction:

Proteins are macromolecules which are comprised of amino acids linked together by peptide or amide bonds. Amino acids are classified into various groups depending on the chemical properties. Some of the amino acids are hydrophilic and some of the amino acids are hydrophobic.

(c)

Expert Solution

Explanation of Solution

Explanation:

Some of the hydrophobic amino acids are alanine (Ala), valine (Val), isoleucine (Ile), leucine (Leu), methionine (Met), phenylalanine (Phe), tyrosine (Tyr), and tryptophan (Trp). Some of the hydrophilic amino acids are lysine (Lys), arginine (Arg), histidine (His), aspartate (Asp), serine (Ser), threonine (Thr), glutamate (Glu), asparagine (Asn), and glutamine (Gln). These amino acids can form an amphipathic helix. Thus, one of the possible sequences can be:

$N-Phe-Ile-Glu-Val-Met-Asn-Ser-Ala-Phe-Gln-C$

Answer 19

(c)

Summary Introduction

To give: A sequence of 10 amino acids that could form an amphipathic helix with left side hydrophilic and right side hydrophobic.

Introduction:

Proteins are macromolecules which are comprised of amino acids linked together by peptide or amide bonds. Amino acids are classified into various groups depending on the chemical properties. Some of the amino acids are hydrophilic and some of the amino acids are hydrophobic.

Answer 20

(c)

Expert Solution

Explanation of Solution

Explanation:

Some of the hydrophobic amino acids are alanine (Ala), valine (Val), isoleucine (Ile), leucine (Leu), methionine (Met), phenylalanine (Phe), tyrosine (Tyr), and tryptophan (Trp). Some of the hydrophilic amino acids are lysine (Lys), arginine (Arg), histidine (His), aspartate (Asp), serine (Ser), threonine (Thr), glutamate (Glu), asparagine (Asn), and glutamine (Gln). These amino acids can form an amphipathic helix. Thus, one of the possible sequences can be:

$N-Phe-Ile-Glu-Val-Met-Asn-Ser-Ala-Phe-Gln-C$

Answer 21

(c)

Expert Solution

Answer 22

(c)

Expert Solution

Answer 23

Expert Solution

Answer 24

(d)

Summary Introduction

To give: One possible double-stranded DNA (deoxyribonucleic acid) sequence of amino acid sequence of $N-Phe-Ile-Glu-Val-Met-Asn-Ser-Ala-Phe-Gln-C$ .

Introduction:

Each amino acid is coded by $3$ nucleotide bases. There are several amino acids which are coded by more than one codon. Such amino acids are known as degenerate amino acids.

(d)

Expert Solution

Explanation of Solution

Explanation:

The sequence of messenger ribonucleic acid (mRNA) is similar to the non-template strand and is complementary to template stand. During transcription, template strand is used as base.

So, one of the possible sequence of mRNA can be

$5′−UUUAUUGAAGUAAUGAAUAGUGCAUUCCAG−3′$

The sequence of the non-template strand of the DNA will be similar to them RNA. The sequence of non-template strand will be as follows:

$5′−TTTATTGAAGTAATGAATAGTGCATTCCAG−3′$

The sequence of the template strand will be complementary to mRNA. The sequence of template strand will be as follows:

$3′−AATAACTTCATTACTTATCACGTAAGGTC−5′$ .

Answer 25

(d)

Summary Introduction

To give: One possible double-stranded DNA (deoxyribonucleic acid) sequence of amino acid sequence of $N-Phe-Ile-Glu-Val-Met-Asn-Ser-Ala-Phe-Gln-C$ .

Introduction:

Each amino acid is coded by $3$ nucleotide bases. There are several amino acids which are coded by more than one codon. Such amino acids are known as degenerate amino acids.

Answer 26

(d)

Expert Solution

Explanation of Solution

Explanation:

The sequence of messenger ribonucleic acid (mRNA) is similar to the non-template strand and is complementary to template stand. During transcription, template strand is used as base.

So, one of the possible sequence of mRNA can be

$5′−UUUAUUGAAGUAAUGAAUAGUGCAUUCCAG−3′$

The sequence of the non-template strand of the DNA will be similar to them RNA. The sequence of non-template strand will be as follows:

$5′−TTTATTGAAGTAATGAATAGTGCATTCCAG−3′$

The sequence of the template strand will be complementary to mRNA. The sequence of template strand will be as follows:

$3′−AATAACTTCATTACTTATCACGTAAGGTC−5′$ .

Answer 27

(d)

Expert Solution

Answer 28

(d)

Expert Solution

Answer 29

Expert Solution

Answer 30

(e)

Summary Introduction

To explain: The amino acids that can be coded by NTN triplet and whether all amino acids in this set are hydrophobic and include all hydrophobic amino acids.

Introduction:

A scientist designed proteins with random sequences and placed hydrophobic and hydrophilic amino acid in a controlled manner. The researchers began with NTN to design a DNA sequence.

(e)

Expert Solution

Explanation of Solution

Explanation:

To encode hydrophobic sequence of amino acids they used NTN codon. In NTN, N refers to any nucleotide base and T refers to Thymine. The codon with uracil at the second position codes for phenylalanine, leucine, isoleucine, methionine, and valine. All of these are hydrophobic amino acids. However, there are certain other hydrophobic amino acids such as tryptophan, alanine, glycine, and proline that are missing.

Answer 31

(e)

Summary Introduction

To explain: The amino acids that can be coded by NTN triplet and whether all amino acids in this set are hydrophobic and include all hydrophobic amino acids.

Introduction:

A scientist designed proteins with random sequences and placed hydrophobic and hydrophilic amino acid in a controlled manner. The researchers began with NTN to design a DNA sequence.

Answer 32

(e)

Expert Solution

Explanation of Solution

Explanation:

To encode hydrophobic sequence of amino acids they used NTN codon. In NTN, N refers to any nucleotide base and T refers to Thymine. The codon with uracil at the second position codes for phenylalanine, leucine, isoleucine, methionine, and valine. All of these are hydrophobic amino acids. However, there are certain other hydrophobic amino acids such as tryptophan, alanine, glycine, and proline that are missing.

Answer 33

(e)

Expert Solution

Answer 34

(e)

Expert Solution

Answer 35

Expert Solution

Answer 36

(f)

Summary Introduction

To explain: The amino acids coded by NAN triplet, whether all amino acids in this set would be polar and include all polar amino acids.

Introduction:

A scientist designed proteins with random sequences and placed hydrophobic and hydrophilic amino acid in a controlled manner. The researchers began with NTN to design a DNA sequence. Then they used NAN to design a DNA sequence.

(f)

Expert Solution

Explanation of Solution

Explanation:

To encode polar sequence of amino acids they used NAN codon. In NAN, N refers to any nucleotide base and A refers to Adenine. The codon with Adenine at the second position codes for tyrosine, histidine, glutamine, asparagines, lysine, aspartate, and glutamate. All of these are polar amino acids. However, there are certain other polar amino acids which are left such as arginine, serine, and threonine are missing.

Answer 37

(f)

Summary Introduction

To explain: The amino acids coded by NAN triplet, whether all amino acids in this set would be polar and include all polar amino acids.

Introduction:

A scientist designed proteins with random sequences and placed hydrophobic and hydrophilic amino acid in a controlled manner. The researchers began with NTN to design a DNA sequence. Then they used NAN to design a DNA sequence.

Answer 38

(f)

Expert Solution

Explanation of Solution

Explanation:

To encode polar sequence of amino acids they used NAN codon. In NAN, N refers to any nucleotide base and A refers to Adenine. The codon with Adenine at the second position codes for tyrosine, histidine, glutamine, asparagines, lysine, aspartate, and glutamate. All of these are polar amino acids. However, there are certain other polar amino acids which are left such as arginine, serine, and threonine are missing.

Answer 39

(f)

Expert Solution

Answer 40

(f)

Expert Solution

Answer 41

Expert Solution

Answer 42

(g)

Summary Introduction

To explain: The reason why T is left out of mixture while creating NAN codons.

Introduction:

To encode polar sequence of amino acids some scientists used the NAN codon. In NAN, N refers to any nucleotide base and A refers to Adenine. This codon was used by certain scientists.

(g)

Expert Solution

Explanation of Solution

Explanation:

In creating NAN codons, it was necessary to keep T out of the reaction mixture. As a consequence of absence of T in the reaction mixture, TAA and TAG will not form. Both of these codons are stop codons.

Answer 43

(g)

Summary Introduction

To explain: The reason why T is left out of mixture while creating NAN codons.

Introduction:

To encode polar sequence of amino acids some scientists used the NAN codon. In NAN, N refers to any nucleotide base and A refers to Adenine. This codon was used by certain scientists.

Answer 44

(g)

Expert Solution

Explanation of Solution

Explanation:

In creating NAN codons, it was necessary to keep T out of the reaction mixture. As a consequence of absence of T in the reaction mixture, TAA and TAG will not form. Both of these codons are stop codons.

Answer 45

(g)

Expert Solution

Answer 46

(g)

Expert Solution

Answer 47

Expert Solution

Answer 48

(h)

Summary Introduction

To explain: The reason behind the failure of grossly misfolded protein to produce a band of expected molecular weight on electrophoresis.

Introduction:

Some scientists cloned the random DNA sequences and selected 48that produced accurate patterning of hydrophobic and hydrophilic amino acids. To test whether the proteins folded accurately they screened for proteins with expected molecular weight on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

(h)

Expert Solution

Explanation of Solution

Explanation:

The proteins which are misfolded or partially folded are degraded by ubiquitin-proteasome complex. The functional proteins are folded properly. So as a consequence of degradation of misfolded proteins, they will not give a separate band on electrophoresis.

Answer 49

(h)

Summary Introduction

To explain: The reason behind the failure of grossly misfolded protein to produce a band of expected molecular weight on electrophoresis.

Introduction:

Some scientists cloned the random DNA sequences and selected 48that produced accurate patterning of hydrophobic and hydrophilic amino acids. To test whether the proteins folded accurately they screened for proteins with expected molecular weight on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

Answer 50

(h)

Expert Solution

Explanation of Solution

Explanation:

The proteins which are misfolded or partially folded are degraded by ubiquitin-proteasome complex. The functional proteins are folded properly. So as a consequence of degradation of misfolded proteins, they will not give a separate band on electrophoresis.

Answer 51

(h)

Expert Solution

Answer 52

(h)

Expert Solution

Answer 53

Expert Solution

Answer 54

(i)

Summary Introduction

To explain: The reason why all random-sequence proteins that passed initial screening test produce four-helix structures.

Introduction:

Some scientists cloned the random DNA sequences and selected 48 that produced accurate patterning of hydrophobic and hydrophilic amino acids. To test whether the proteins folded accurately they screened for proteins with expected molecular weight on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

(i)

Expert Solution

Explanation of Solution

Explanation:

There are certain specific criteria for production of four-helix structures. Even a single amino acid difference will result in different folding patterns of whole peptide. Four-helix peptide is holded together by Van der Waals forces and hydrophobic interactions. Steric hindrance might be another reason behind not folding into four-helix peptide.

Answer 55

(i)

Summary Introduction

To explain: The reason why all random-sequence proteins that passed initial screening test produce four-helix structures.

Introduction:

Some scientists cloned the random DNA sequences and selected 48 that produced accurate patterning of hydrophobic and hydrophilic amino acids. To test whether the proteins folded accurately they screened for proteins with expected molecular weight on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

Answer 56

(i)

Expert Solution

Explanation of Solution

Explanation:

There are certain specific criteria for production of four-helix structures. Even a single amino acid difference will result in different folding patterns of whole peptide. Four-helix peptide is holded together by Van der Waals forces and hydrophobic interactions. Steric hindrance might be another reason behind not folding into four-helix peptide.