Chapter 27, Problem 22DAP

(a)

Summary Introduction

To explain: The forces responsible for holding the four α helices together in the bundled structure.

Introduction:

Some scientists utilized various aspects of genetic code to generate protein sequences with defined hydrophobic and hydrophilic residues. Through this they explored the factors that affect structure of protein. They generated a set of proteins with simple four-helix bundle structure which were connected by random coils.

Explanation of Solution

Explanation:

Since the scientists utilized defined patterns of hydrophobic and hydrophilic residues, the hydrophobic chains in the four α-helices face each other. They will form hydrophobic interaction. Non-covalent interactions such as hydrophobic interactions and weak Van der Waals force hold together four α-helices.

(b)

Summary Introduction

To number: The R groups which extend from right side and the groups which extend from left side in Fig. 4-4a.

Introduction: Refer Fig. 4-4a: “Models of the α-helix, showing different aspects of its structure” in the textbook. There is a central gray rod. Four of the purple spheres extend from left side and six of R groups extend from right.

Explanation of Solution

Explanation:

The numbering of extended R groups starts from top to bottom. The first extending R group is towards the right side, and the second group also extends to the right side. Third R group extends to the left side. Fourth and fifth group extends toward the right side. Seventh group extends from left side. Eighth and ninth group extends from right side and lastly, the tenth group extends from left side. So R group 1, 2, 4, 5, 8, and 9 extends to right side and R group 3, 6, 7, and 10 extends to the left side.

(c)

Summary Introduction

To give: A sequence of 10 amino acids that could form an amphipathic helix with left side hydrophilic and right side hydrophobic.

Introduction:

Proteins are macromolecules which are comprised of amino acids linked together by peptide or amide bonds. Amino acids are classified into various groups depending on the chemical properties. Some of the amino acids are hydrophilic and some of the amino acids are hydrophobic.

Explanation of Solution

Explanation:

Some of the hydrophobic amino acids are alanine (Ala), valine (Val), isoleucine (Ile), leucine (Leu), methionine (Met), phenylalanine (Phe), tyrosine (Tyr), and tryptophan (Trp). Some of the hydrophilic amino acids are lysine (Lys), arginine (Arg), histidine (His), aspartate (Asp), serine (Ser), threonine (Thr), glutamate (Glu), asparagine (Asn), and glutamine (Gln). These amino acids can form an amphipathic helix. Thus, one of the possible sequences can be:

$N\text{-Phe-Ile-Glu-Val-Met-Asn-Ser-Ala-Phe-Gln-}C$

(d)

Summary Introduction

To give: One possible double-stranded DNA (deoxyribonucleic acid) sequence of amino acid sequence of $N\text{-Phe-Ile-Glu-Val-Met-Asn-Ser-Ala-Phe-Gln-}C$.

Introduction:

Each amino acid is coded by $3$ nucleotide bases. There are several amino acids which are coded by more than one codon. Such amino acids are known as degenerate amino acids.

Explanation of Solution

Explanation:

The sequence of messenger ribonucleic acid (mRNA) is similar to the non-template strand and is complementary to template stand. During transcription, template strand is used as base.

So, one of the possible sequence of mRNA can be

$5^{\prime }-\text{UUUAUUGAAGUAAUGAAUAGUGCAUUCCAG}-3^{\prime }$

The sequence of the non-template strand of the DNA will be similar to them RNA. The sequence of non-template strand will be as follows:

${\text{5}}^{\prime }-\text{TTTATTGAAGTAATGAATAGTGCATTCCAG}-{\text{3}}^{\prime }$

The sequence of the template strand will be complementary to mRNA. The sequence of template strand will be as follows:

${\text{3}}^{\prime }-\text{AATAACTTCATTACTTATCACGTAAGGTC}-{\text{5}}^{\prime }$.

(e)

Summary Introduction

To explain: The amino acids that can be coded by NTN triplet and whether all amino acids in this set are hydrophobic and include all hydrophobic amino acids.

Introduction:

A scientist designed proteins with random sequences and placed hydrophobic and hydrophilic amino acid in a controlled manner. The researchers began with NTN to design a DNA sequence.

Explanation of Solution

Explanation:

To encode hydrophobic sequence of amino acids they used NTN codon. In NTN, N refers to any nucleotide base and T refers to Thymine. The codon with uracil at the second position codes for phenylalanine, leucine, isoleucine, methionine, and valine. All of these are hydrophobic amino acids. However, there are certain other hydrophobic amino acids such as tryptophan, alanine, glycine, and proline that are missing.

(f)

Summary Introduction

To explain: The amino acids coded by NAN triplet, whether all amino acids in this set would be polar and include all polar amino acids.

Introduction:

A scientist designed proteins with random sequences and placed hydrophobic and hydrophilic amino acid in a controlled manner. The researchers began with NTN to design a DNA sequence. Then they used NAN to design a DNA sequence.

Explanation of Solution

Explanation:

To encode polar sequence of amino acids they used NAN codon. In NAN, N refers to any nucleotide base and A refers to Adenine. The codon with Adenine at the second position codes for tyrosine, histidine, glutamine, asparagines, lysine, aspartate, and glutamate. All of these are polar amino acids. However, there are certain other polar amino acids which are left such as arginine, serine, and threonine are missing.

(g)

Summary Introduction

To explain: The reason why T is left out of mixture while creating NAN codons.

Introduction:

To encode polar sequence of amino acids some scientists used the NAN codon. In NAN, N refers to any nucleotide base and A refers to Adenine. This codon was used by certain scientists.

Explanation of Solution

Explanation:

In creating NAN codons, it was necessary to keep T out of the reaction mixture. As a consequence of absence of T in the reaction mixture, TAA and TAG will not form. Both of these codons are stop codons.

(h)

Summary Introduction

To explain: The reason behind the failure of grossly misfolded protein to produce a band of expected molecular weight on electrophoresis.

Introduction:

Some scientists cloned the random DNA sequences and selected 48that produced accurate patterning of hydrophobic and hydrophilic amino acids. To test whether the proteins folded accurately they screened for proteins with expected molecular weight on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

Explanation of Solution

Explanation:

The proteins which are misfolded or partially folded are degraded by ubiquitin-proteasome complex. The functional proteins are folded properly. So as a consequence of degradation of misfolded proteins, they will not give a separate band on electrophoresis.

(i)

Summary Introduction

To explain: The reason why all random-sequence proteins that passed initial screening test produce four-helix structures.

Introduction:

Some scientists cloned the random DNA sequences and selected 48 that produced accurate patterning of hydrophobic and hydrophilic amino acids. To test whether the proteins folded accurately they screened for proteins with expected molecular weight on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

Explanation of Solution

Explanation:

There are certain specific criteria for production of four-helix structures. Even a single amino acid difference will result in different folding patterns of whole peptide. Four-helix peptide is holded together by Van der Waals forces and hydrophobic interactions. Steric hindrance might be another reason behind not folding into four-helix peptide.