
Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
12th Edition
ISBN: 9780135755785
Author: Gerald Audesirk, Teresa Audesirk
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Question
Chapter 27, Problem 1AC
Summary Introduction
To determine: The factors that sustain the rapid population growth of developing countries such as Nigeria, Afghanistan, or Uganda.
Introduction: The changes in a population number could be due to the birth rate, death rate, immigration, and emigration. Birth and immigration lead to add individuals to a population and death and emigration lead to decrease in the number of individuals from a population. A wide gap between the birth and death rate could lead to faster growth in the rate of population.
Summary Introduction
To assess: The likelihood that the fertility rate of developing country will drop in the near future.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 27 Solutions
Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
Ch. 27.1 - Prob. 1CSCCh. 27.1 - Prob. 1HYEWCh. 27.1 - The Return of the Elephant Seals Female elephant...Ch. 27.1 - Prob. 1CYLCh. 27.1 - describe how the growth rate interacts with...Ch. 27.1 - Prob. 3CYLCh. 27.2 - What factors might make these population data...Ch. 27.2 - Prob. 2TCCh. 27.2 - What benefits does mass emigration give to animals...Ch. 27.2 - Prob. 1CSC
Ch. 27.2 - Prob. 1CYLCh. 27.2 - Prob. 2CYLCh. 27.2 - Prob. 3CYLCh. 27.3 - Prob. 1CYLCh. 27.3 - Prob. 2CYLCh. 27.3 - Prob. 3CYLCh. 27.4 - Prob. 1CYLCh. 27.4 - Prob. 1CTCh. 27.5 - Prob. 1TCCh. 27.5 - Prob. 2TCCh. 27.5 - Prob. 3TCCh. 27.5 - describe the advances that have allowed...Ch. 27.5 - explain why rapid population growth continues...Ch. 27.5 - Prob. 3CYLCh. 27.5 - Prob. 4CYLCh. 27 - Prob. 1MCCh. 27 - Prob. 2MCCh. 27 - Prob. 3MCCh. 27 - Prob. 4MCCh. 27 - Prob. 5MCCh. 27 - Prob. 1FIBCh. 27 - The type of growth that occurs in a population...Ch. 27 - Prob. 3FIBCh. 27 - The type of spatial distribution likely to occur...Ch. 27 - Prob. 5FIBCh. 27 - Prob. 1RQCh. 27 - Prob. 2RQCh. 27 - Draw, name, and describe the properties of a...Ch. 27 - Prob. 4RQCh. 27 - What is logistic population growth? What is K?Ch. 27 - Prob. 6RQCh. 27 - Distinguish between populations showing concave...Ch. 27 - Prob. 8RQCh. 27 - Prob. 9RQCh. 27 - Prob. 1ACCh. 27 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Essentials Health Info Management Principles/Prac...Health & NutritionISBN:9780357191651Author:BowiePublisher:CengageBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Essentials Health Info Management Principles/Prac...
Health & Nutrition
ISBN:9780357191651
Author:Bowie
Publisher:Cengage

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Fossils & Evidence For Evolution | Evolution | Biology | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=iYr3sYS9e0w;License: Standard YouTube License, CC-BY
Dig In To Paleontology; Author: SciShow Kids;https://www.youtube.com/watch?v=1FjyKmpmQzc;License: Standard YouTube License, CC-BY