Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 26.2, Problem 1MQ
Describe host tissue specificity for pathogens.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 26 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 26.1 - What major class of immune cells mediates an...Ch. 26.1 - Prob. 2MQCh. 26.1 - Compare and contrast the major features of innate...Ch. 26.2 - Describe host tissue specificity for pathogens.Ch. 26.2 - Identify physical and chemical barriers to...Ch. 26.2 - What other factors may control the outcome of an...Ch. 26.2 - Identify at least four mechanisms by which a...Ch. 26.3 - Describe the circulation of a leukocyte from the...Ch. 26.3 - What soluble molecules determine whether a...Ch. 26.3 - Cells involved in innate and adaptive immunity...
Ch. 26.4 - How does the development of B, T, and NK cells...Ch. 26.4 - Distinguish between the primary lymphoid organs...Ch. 26.4 - Leukocytes are differentiated white blood cells...Ch. 26.5 - Although technically not part of the immune...Ch. 26.5 - Describe the mechanisms by which circulating...Ch. 26.5 - Pathogens may colonize host tissues when...Ch. 26.6 - Identify a PAMP shared by a group of...Ch. 26.6 - Outline the general features of a signal...Ch. 26.6 - Innate recognition of common pathogens occurs...Ch. 26.7 - Identify the mechanism used by phagocytes to...Ch. 26.7 - Describe several reasons why phagocytes are not...Ch. 26.7 - Phagocytosis is the engulfing of infectious...Ch. 26.8 - Prob. 1MQCh. 26.8 - Identify the major symptoms of localized...Ch. 26.8 - Fever and inflammation, characterized by pain,...Ch. 26.9 - In what ways does the classical pathway of...Ch. 26.9 - What is opsonization, and how does opsonization...Ch. 26.9 - Why are the mannose-binding lectin and alternative...Ch. 26.9 - The complement system is composed of soluble...Ch. 26.10 - Prob. 1MQCh. 26.10 - Prob. 2MQCh. 26.10 - Prob. 1CRCh. 26 - Prob. 1AQCh. 26 - Describe the potential problems that would arise...Ch. 26 - Prob. 3AQCh. 26 - Prob. 4AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Microbiology for Surgical Technologists (MindTap ...BiologyISBN:9781111306663Author:Margaret Rodriguez, Paul PricePublisher:Cengage LearningHealth Safety And Nutrition F/Young ChildHealth & NutritionISBN:9781305144767Author:MAROTZPublisher:Cengage
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Microbiology for Surgical Technologists (MindTap ...
Biology
ISBN:9781111306663
Author:Margaret Rodriguez, Paul Price
Publisher:Cengage Learning
Health Safety And Nutrition F/Young Child
Health & Nutrition
ISBN:9781305144767
Author:MAROTZ
Publisher:Cengage
Infectious Diseases - How do we control them?; Author: Let's Learn Public Health;https://www.youtube.com/watch?v=2JWku3Kjpq0;License: Standard Youtube License