Concept explainers
Introduction: Two different environments, namely terrestrial and aquatic, were produced as the Earth cooled. The major landmasses shifted their positions and separated from each other over the course of billions of years.

Answer to Problem 1TY
Correct answer: The movement of landmasses that has changed their position, shapes and association with other landmasses is called continental drift. Hence, the correct answer is option c.
Explanation of Solution
Reason for correct answer:
Over the course of billions of years, the major landmasses shifted their positions, changed their shapes and separated from each other. This phenomenon is called continental drift.
Option c. is given as “continental drift”.
The movement of landmasses (change in position, shapes, and association with other landmasses) is called continental drift. Hence, the correct answer is option c.
Reasons for incorrect answer:
Option a. is given as, “glaciation”.
Glaciation is the movement of glaciers across continents. This alter the composition of species on those landmasses. Hence, option a. is incorrect.
Option b. is given as, “Pangaea”.
At the beginning of the Permian period, the continental drift brought together most of the Earth’s total land into a supercontinent known as Pangaea. Hence, option b. is incorrect.
Option d. is given as, “biogeography”.
Biogeography is defined as the study of the geographic distribution of extinct and living species. Hence, option d. is incorrect.
Option e. is given as, “geological scale”.
The geological scale is used by geologists and researchers to map the timing and relationships between events that have occurred during the history of the Earth. Hence, option e. is incorrect.
Hence, the options a., b., d., and e. are incorrect.
Thus, it can be concluded that continental drift is the movement of landmasses that has changed their position, shapes, and association with other landmasses.
Want to see more full solutions like this?
Chapter 26 Solutions
BIOLOGY (LL)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning





