Inquiry into Life
14th Edition
ISBN: 9780073525525
Author: Mader, Sylvia S./
Publisher: McGraw-Hill College
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 25.3, Problem 3CYP
Discuss why the genetic code is said to be degenerate.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
List a few exceptions to the genetic code.
Discuss exceptions found in mitochondria to theuniversal genetic code.
What is the biological significance of the extensive degeneracy of the genetic code?
Chapter 25 Solutions
Inquiry into Life
Ch. 25.1 - Summarize the experiment that enabled scientist to...Ch. 25.1 - Prob. 2LOCh. 25.1 - Summarize the significance off the Griffith and...Ch. 25.1 - Prob. 2CYPCh. 25.1 - Prob. 3CYPCh. 25.1 - Based on Chargaff’s rules, if a segment of DNA is...Ch. 25.1 - Watson and Crick’s discovery of DNA is clearly one...Ch. 25.1 - Prob. 3QTCCh. 25.2 - Prob. 1LOCh. 25.2 - Prob. 2LO
Ch. 25.2 - Explain why DNA replication is said to be...Ch. 25.2 - Prob. 2CYPCh. 25.3 - Describe the role of RNA molecules in gene...Ch. 25.3 - Prob. 2LOCh. 25.3 - Prob. 3LOCh. 25.3 - Prob. 4LOCh. 25.3 - Prob. 1CYPCh. 25.3 - Describe the movement of information from the...Ch. 25.3 - Discuss why the genetic code is said to be...Ch. 25.4 - Prob. 1LOCh. 25.4 - Prob. 2LOCh. 25.4 - Prob. 3LOCh. 25.4 - Prob. 1CYPCh. 25.4 - Prob. 2CYPCh. 25.4 - Prob. 3CYPCh. 25.5 - Summarize the causes of gene mutations.Ch. 25.5 - Prob. 2LOCh. 25.5 - Prob. 3LOCh. 25.5 - Which of these cancer preventive measures are you...Ch. 25.5 - Why do you think tobacco use increase the risk of...Ch. 25.5 - Why does the use of tanning beds also increase the...Ch. 25.5 - Prob. 1CYPCh. 25.5 - Prob. 2CYPCh. 25.5 - Prob. 3CYPCh. 25.5 - Prob. 1AQTCCh. 25.5 - Prob. 2AQTCCh. 25.5 - Prob. 3AQTCCh. 25 - Prob. F2.6BYBCh. 25 - Section 2.8 How does the structure of DNA differ...Ch. 25 - Prob. S23.1BYBCh. 25 - How is that information in the DNA interpreted...Ch. 25 - How might mutation in the DNA result in the...Ch. 25 - Prob. 1ACh. 25 - Prob. 2ACh. 25 - Prob. 3ACh. 25 - Prob. 4ACh. 25 - Prob. 5ACh. 25 - Prob. 6ACh. 25 - Prob. 7ACh. 25 - Prob. 8ACh. 25 - Prob. 9ACh. 25 - Prob. 10ACh. 25 - Prob. 11ACh. 25 - Prob. 12ACh. 25 - Prob. 13ACh. 25 - Prob. 14ACh. 25 - Prob. 15ACh. 25 - Prob. 1TCCh. 25 - Prob. 2TCCh. 25 - Prob. 3TC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is meant by the statement “The genetic code is universal”? What is the significance of this finding?arrow_forwardKnowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human - globin gene (shown in the figure below (Links to an external site.)) into bacterial cells, hoping the cells will express it and synthesize functional - globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does -globin made by a eukaryotic cell. Explain why and give thoughts as to how to overcome this.arrow_forwardWhat does “Universality and Degeneracy” of the Genetic Code mean? State the significance of both the code’s Universality and Degeneracy.arrow_forward
- Explain the significance of the following statement: The functioning of the aminoacyl-tRNA synthetases is referred to as the second genetic code.arrow_forwardDefine Nonuniversal codons as they apply to the genetic codearrow_forwardKnowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.arrow_forward
- As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardbriefly explain the importance of the degeneracy of the genetic code in the translation process. do not simply define the givenarrow_forwardExplain why a minimum of 32 tRNAs are required to translate the “standard” genetic code.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Biology - Intro to Cell Structure - Quick Review!; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=vwAJ8ByQH2U;License: Standard youtube license