
Microbiology: A Systems Approach
5th Edition
ISBN: 9781259706615
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 25.3, Problem 15AYP
Summary Introduction
To describe:
10-year trends in the incidence of food-borne illness within the United States.
Concept introduction:
FDA- Food and Drug Administration is an organization that regulates the food industry. It uses a management system namely HACCP- Hazard Analysis and Critical Control Point- to evaluate the hazards involving production, harvesting, processing, and distribution of food products. Hazards occurring at every stage of the process of food production is identified, evaluated, controlled and prevented by the HACCP. This helps in the prevention of food-borne illness caused by various pathogens.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 25 Solutions
Microbiology: A Systems Approach
Ch. 25.1 - Compose a sentence about the history of applied...Ch. 25.1 - Define biotechnology, and explain how its uses...Ch. 25.2 - Outline the steps in water purification.Ch. 25.2 - Differentiate water purification from sewage...Ch. 25.2 - Prob. 5AYPCh. 25.2 - Prob. 6AYPCh. 25.2 - List five important pathogens of drinking water.Ch. 25.2 - Provide examples of indicator bacteria, and...Ch. 25.2 - Summarize methods for identifying and quantifying...Ch. 25.3 - Name five foods and/or beverages that are produced...
Ch. 25.3 - Summarize the microbial process that leads to...Ch. 25.3 - Write the equation showing how yeasts convert...Ch. 25.3 - Discuss how microorganisms themselves are useful...Ch. 25.3 - Provide background on current HACCP guidelines,...Ch. 25.3 - Prob. 15AYPCh. 25.3 - Outline basic principles of using temperature to...Ch. 25.3 - List methods other than temperature currently used...Ch. 25.4 - Prob. 18AYPCh. 25.4 - Distinguish between primary and secondary...Ch. 25.4 - List the four steps of industrial product...Ch. 25.4 - Identify five industrial products made by...Ch. 25 - Drinking water utilities monitor their production...Ch. 25 - Milk is usually pasteurized by a. the...Ch. 25 - During sewage treatment, microbial action on a...Ch. 25 - Which of the following is unlikely to be a...Ch. 25 - The bloom in wine making refers to a. the...Ch. 25 - When algae produce biofuels, what is the other...Ch. 25 - Secondary metabolites of microbes are formed...Ch. 25 - In industrial fermentation, which step precedes...Ch. 25 - Which of the following is currently being produced...Ch. 25 - In biotechnology, fermentation refers to a. the...Ch. 25 - Prob. 11TFCh. 25 - Food products should always be kept completely...Ch. 25 - Alcoholic beverages are produced by the...Ch. 25 - Nutritional yeast is consumed by humans to...Ch. 25 - Refrigerating food prevents the growth of all...Ch. 25 - a.Summarize one beneficial use of sludge today,...Ch. 25 - Every year, supposedly safe municipal water...Ch. 25 - Provide evidence in support of or refuting the...Ch. 25 - a.List examples of microbes used in the production...Ch. 25 - Further investigate the HACCP system, and...Ch. 25 - From chapter 3, figure 3.5b. If this MacConkey...Ch. 25 - From chapter 8. During which portion of metabolism...Ch. 25 - Using the words that follow, please create a...
Knowledge Booster
Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Nutrition Through The Life CycleHealth & NutritionISBN:9781337919333Author:Brown, Judith E.Publisher:Cengage Learning,Lifetime Physical Fitness & WellnessHealth & NutritionISBN:9781337677509Author:HOEGERPublisher:CengageHealth Safety And Nutrition F/Young ChildHealth & NutritionISBN:9781305144767Author:MAROTZPublisher:Cengage
- Understanding Nutrition (MindTap Course List)Health & NutritionISBN:9781337392693Author:Eleanor Noss Whitney, Sharon Rady RolfesPublisher:Cengage LearningUnderstanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage

Nutrition Through The Life Cycle
Health & Nutrition
ISBN:9781337919333
Author:Brown, Judith E.
Publisher:Cengage Learning,
Lifetime Physical Fitness & Wellness
Health & Nutrition
ISBN:9781337677509
Author:HOEGER
Publisher:Cengage
Health Safety And Nutrition F/Young Child
Health & Nutrition
ISBN:9781305144767
Author:MAROTZ
Publisher:Cengage

Understanding Nutrition (MindTap Course List)
Health & Nutrition
ISBN:9781337392693
Author:Eleanor Noss Whitney, Sharon Rady Rolfes
Publisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage