
EP PRINCIPLES OF HUM.PHYS.-MOD.MAST.A+P
6th Edition
ISBN: 9780134407166
Author: STANFIELD
Publisher: PEARSON CO
expand_more
expand_more
format_list_bulleted
Question
Chapter 2.5, Problem 1aCTQ
Summary Introduction
To determine:
The mechanism by which ricin induces death.
Introduction:
Ricin is found in the castor beans and if castor beans are chewed and swallowed, then they may cause injury due to their poisonous nature. It can also be obtained from the waste material left by the processing of castor beans. The grain sized dose of ricin is sufficient to kill the person.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 2 Solutions
EP PRINCIPLES OF HUM.PHYS.-MOD.MAST.A+P
Ch. 2.1 - Prob. 2.1.1QCCh. 2.1 - Prob. 2.1.2QCCh. 2.1 - Prob. 2.1.3QCCh. 2.1 -
List the four types of chemical interactions...Ch. 2.2 - How does the impact Of Tay Sachs on the...Ch. 2.2 - In order to eradicate genetic diseases, such as...Ch. 2.2 - What would be the advantages and disadvantages of...Ch. 2.2 - Prob. 2.2.1QCCh. 2.2 - Prob. 2.2.2QCCh. 2.2 - Prob. 2.2.3QC
Ch. 2.2 - Prob. 2.2.4QCCh. 2.4 - Prob. 2.3.1QCCh. 2.4 - Describe the role of transmembrane proteins in the...Ch. 2.5 -
Why is only maternal mitochondrial DNA passed to...Ch. 2.5 -
How can mDNA. Be used to determine ancestry?
Ch. 2.5 - What are some diseases related to genetic...Ch. 2.5 -
Define transcription and translation. Where in...Ch. 2.5 -
Describe the functions of RNA polymerase in...Ch. 2.5 -
What is the name of the first of a polypeptide...Ch. 2.5 - Prob. 1aCTQCh. 2.5 - Why would preventing the larger ribosomal subunit...Ch. 2.5 - If ricin B induced exocytosis rather than...Ch. 2.6 -
Explain why and how a mutation in a...Ch. 2.6 -
Which characteristic(s) of cancer cells are...Ch. 2.6 - Prob. 3CTQCh. 2.6 - Prob. 2.5.1QCCh. 2.6 - Name the five stages of mitosis. During which...Ch. 2 - Prob. 1ECh. 2 - Prob. 2ECh. 2 -
Which of the following molecules is not a...Ch. 2 - Hydrogen bonding between the amino hydrogen of one...Ch. 2 -
Which of the following nucleic acids is not a...Ch. 2 - Prob. 6ECh. 2 - Prob. 7ECh. 2 - Prob. 8ECh. 2 - Prob. 9ECh. 2 - Prob. 10ECh. 2 - Prob. 11ECh. 2 - Prob. 12ECh. 2 - Prob. 13ECh. 2 -
During which phase of mitosis is the mitotic...Ch. 2 -
During which phase of mitosis do the chromosome...Ch. 2 -
Monosaccharides are (polar/nonpolar/amphipathic)...Ch. 2 - Triglycerides are (polar/nonpolar/amphipathic)...Ch. 2 - Prob. 18ECh. 2 - Prob. 19ECh. 2 - Prob. 20ECh. 2 - Prob. 21ECh. 2 - Prob. 22ECh. 2 - Prob. 23ECh. 2 - Prob. 24ECh. 2 - Prob. 25ECh. 2 - Prob. 26ECh. 2 -
The first section of a polypeptide to be...Ch. 2 -
Replication of DNA occurs during...Ch. 2 -
Division of the cytoplasm into two daughter...Ch. 2 - Prob. 30ECh. 2 - Prob. 31ECh. 2 - Prob. 32ECh. 2 -
Describe the structure of the plasma membrane....Ch. 2 - Prob. 34ECh. 2 - Prob. 35ECh. 2 - Prob. 36ECh. 2 - Prob. 37ECh. 2 - Prob. 38ECh. 2 -
Draw a flowchart showing the synthesis of...Ch. 2 -
Plasma, which is the fluid portion of blood, is...Ch. 2 -
Name some factors that cause cancer and potential...Ch. 2 - Prob. 42ECh. 2 - Prob. 43ECh. 2 - Prob. 44E
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education