
Anatomy & Physiology
3rd Edition
ISBN: 9781259398629
Author: McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher: Mcgraw Hill Education,
expand_more
expand_more
format_list_bulleted
Question
Chapter 24.5, Problem 28LO
Summary Introduction
To define: Glomerular filtration rate and the factors that influence it.
Introduction: Filtrate is produced due to the difference between the hydrostatic pressure of the blood in the glomerulus and the opposing pressure of both the osmotic blood pressure and the fluid pressure in the capsular space of the renal corpuscle. The difference is known as the net filtration pressure.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Aerobic respiration of one lipid molecule. The lipid is composed of one glycerol molecule connected to two
fatty acid tails. One fatty acid is 12 carbons long and the other fatty acid is 18 carbons long in the figure
below. Use the information below to determine how much ATP will be produced from the glycerol part of
the lipid. Then, in part B, determine how much ATP is produced from the 2 fatty acids of the lipid. Finally
put the NADH and ATP yields together from the glycerol and fatty acids (part A and B) to determine your
total number of ATP produced per lipid. Assume no other carbon source is available.
18 carbons
fatty acids
12 carbons
glycerol
. Glycerol is broken down to glyceraldehyde 3-phosphate, a glycolysis intermediate via the following
pathway shown in the figure below. Notice this process costs one ATP but generates one FADH2. Continue
generating ATP with glyceraldehyde-3-phosphate using the standard pathway and aerobic respiration.
glycerol
glycerol-3-
phosphate…
Don't copy the other answer
4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is
equivalent to acetyl-CoA.
NADH
FADH2
OP ATP
SLP ATP
Total ATP
Show your work using dimensional analysis here:
5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source.
NADH
FADH2
OP ATP
Show your work using dimensional analysis here:
SLP ATP
Total ATP
Chapter 24 Solutions
Anatomy & Physiology
Ch. 24.1 - Prob. 1LOCh. 24.1 - Prob. 2LOCh. 24.1 - WHAT DO YOU THINK?
1 Which of the following would...Ch. 24.1 - Which structure of the urinary system forms urine,...Ch. 24.1 - What are the two means by which the kidney helps...Ch. 24.2 - Prob. 3LOCh. 24.2 - Prob. 4LOCh. 24.2 - What tissue composes the fibrous capsule that...Ch. 24.2 - Prob. 5LOCh. 24.2 - Prob. 6LO
Ch. 24.2 - What are the regions of the kidney that drain...Ch. 24.2 - Prob. 7LOCh. 24.2 - What three anatomic structures of the kidney are...Ch. 24.3 - Prob. 8LOCh. 24.3 - Prob. 9LOCh. 24.3 - Prob. 10LOCh. 24.3 - What two structures compose the renal corpuscle?...Ch. 24.3 - What is the order of the components of a renal...Ch. 24.3 - What differences exist between cortical and...Ch. 24.3 - Prob. 11LOCh. 24.3 - Prob. 12LOCh. 24.3 - Differentiate between the function of principal...Ch. 24.3 - Prob. 13LOCh. 24.3 - Prob. 14LOCh. 24.3 - Prob. 15LOCh. 24.3 - What are the two primary cellular components of...Ch. 24.4 - Prob. 16LOCh. 24.4 - Prob. 17LOCh. 24.4 - Prob. 18LOCh. 24.4 - What is the pathway that blood follows as it...Ch. 24.4 - What are the three major types of capillaries...Ch. 24.4 - Prob. 19LOCh. 24.4 - LEARNING OBJECTIVE
20. Trace the fluid from its...Ch. 24.4 - What is the pathway of fluid filtered by the...Ch. 24.5 - Prob. 21LOCh. 24.5 - How does tubular reabsorption differ from tubular...Ch. 24.5 - Prob. 22LOCh. 24.5 - WHAT DO YOU THINK?
2 If a substance within the...Ch. 24.5 - How are the components of the filtration membrane...Ch. 24.5 - Prob. 23LOCh. 24.5 - Prob. 24LOCh. 24.5 - What is normally filtered across the glomerular...Ch. 24.5 - Prob. 17WDLCh. 24.5 - Prob. 25LOCh. 24.5 - Prob. 26LOCh. 24.5 - LEARNING OBJECTIVE
27. Explain how to calculate...Ch. 24.5 - Prob. 28LOCh. 24.5 - WHAT DO YOU THINK?
3 An individual with cirrhosis...Ch. 24.5 - What is the value of the NFP if the glomerular...Ch. 24.5 - Prob. 19WDLCh. 24.5 - If HPg increases, what is the effect on NFP? Is...Ch. 24.5 - LEARNING OBJECTIVE
29. Describe what is meant by...Ch. 24.5 - Prob. 30LOCh. 24.5 - Prob. 31LOCh. 24.5 - Prob. 32LOCh. 24.5 - Does urine production increase, decrease, or stay...Ch. 24.5 - What are the three factors that regulate...Ch. 24.5 - Prob. 23WDLCh. 24.6 - Prob. 33LOCh. 24.6 - What are the significant anatomic and physiologic...Ch. 24.6 - Prob. 34LOCh. 24.6 - Prob. 35LOCh. 24.6 - Prob. 4WDTCh. 24.6 - What is the transport maximum of a substance? How...Ch. 24.6 - Prob. 36LOCh. 24.6 - Prob. 37LOCh. 24.6 - Prob. 5WDTCh. 24.6 - How is glucose reabsorbed across the two membranes...Ch. 24.6 - Why are proteins said to be transported rather...Ch. 24.6 - Prob. 38LOCh. 24.6 - Prob. 39LOCh. 24.6 - Prob. 40LOCh. 24.6 - Prob. 41LOCh. 24.6 - Prob. 6WDTCh. 24.6 - How does Na+ reabsorption occur? Which two...Ch. 24.6 - What is the effect of parathyroid hormone on the...Ch. 24.6 - How is the movement of H+ and HCO3 regulated by...Ch. 24.6 - Prob. 42LOCh. 24.6 - Prob. 43LOCh. 24.6 - Prob. 31WDLCh. 24.6 - Prob. 44LOCh. 24.6 - Prob. 45LOCh. 24.6 - Prob. 46LOCh. 24.6 - How is the concentration gradient that is...Ch. 24.6 - Which substances are reabsorbed in tubular...Ch. 24.7 - Prob. 47LOCh. 24.7 - Prob. 48LOCh. 24.7 - What is the purpose of measuring the glomerular...Ch. 24.7 - Prob. 49LOCh. 24.7 - Prob. 50LOCh. 24.7 - What information is gained by measuring the renal...Ch. 24.8 - Prob. 51LOCh. 24.8 - Prob. 52LOCh. 24.8 - What characteristics are used to describe urine?...Ch. 24.8 - Prob. 53LOCh. 24.8 - Prob. 54LOCh. 24.8 - Prob. 55LOCh. 24.8 - Prob. 7WDTCh. 24.8 - What are the major components of the urinary...Ch. 24.8 - How does the urethra of a male and female differ?Ch. 24.8 - Prob. 56LOCh. 24.8 - LEARNING OBJECTIVE
57. Compare and contrast the...Ch. 24.8 - Prob. 58LOCh. 24.8 - What steps lead to micturition? At what point does...Ch. 24 - _____ 1. All of following are functions of the...Ch. 24 - _____ 2. When the kidneys are described as being...Ch. 24 - _____ 3. Which of the following is located within...Ch. 24 - _____ 4. All of the following are capillaries...Ch. 24 - _____ 5. Which of the following is a component of...Ch. 24 - _____ 6. If blood pressure in the glomerulus...Ch. 24 - _____ 7. Which hormone increases Na+ and water...Ch. 24 - _____ 8. If the tubular maximum is exceeded, then...Ch. 24 - _____ 9. The function unique to the nephron loop...Ch. 24 - _____ 10. If antidiuretic hormone (ADH)...Ch. 24 - Trace blood flow into and out of the kidney....Ch. 24 - Describe where filtrate, tubular fluid, and urine...Ch. 24 - Describe the anatomic components of the...Ch. 24 - Prob. 14DYBCh. 24 - Explain how glomerular filtration rate (GFR) is...Ch. 24 - Discuss the affect of aldosterone and antidiuretic...Ch. 24 - Explain how antidiuretic hormone (ADH) is...Ch. 24 - Describe the significant differences between blood...Ch. 24 - Identify all of the following that are functions...Ch. 24 - Explain the process of micturition.Ch. 24 - Use the following paragraph to answer questions...Ch. 24 - Prob. 2CALCh. 24 - Prob. 3CALCh. 24 - Martin, a young man of 20, was in a car accident...Ch. 24 - A 19-year-old male named Paul was in a diving...Ch. 24 - A patient with cancer is treated with...Ch. 24 - Prob. 2CSLCh. 24 - Males who suffer from either benign prostatic...
Knowledge Booster
Similar questions
- Biology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forwardWrite the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forward
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education