
Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
12th Edition
ISBN: 9780135755785
Author: Gerald Audesirk, Teresa Audesirk
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 24.3, Problem 7TC
Summary Introduction
To determine: The way in which the insect wings have contributed to their diversity and abundance.
Introduction: Insects or insecta are a large group of hexapod invertebrates under the phylum arthropoda. They show chitinous exoskeleton, segmented bodies, and jointed appendages.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Chapter 24 Solutions
Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
Ch. 24.1 - Can you... list the characteristics that...Ch. 24.2 - Prob. 1CYLCh. 24.2 - describe the different types of body symmetry,...Ch. 24.2 - give examples of animal groups with each type of...Ch. 24.2 - Prob. 4CYLCh. 24.3 - Prob. 1TCCh. 24.3 - Prob. 2TCCh. 24.3 - Prob. 3TCCh. 24.3 - What advantage does a digestive system with two...Ch. 24.3 - Why does pouring sail on a leech harm it?
Ch. 24.3 - Prob. 6TCCh. 24.3 - Prob. 7TCCh. 24.3 - If you have ever accidentally walked into a spider...Ch. 24.3 - Prob. 1CYLCh. 24.3 - list some member organisms in each of these...Ch. 24.3 - Prob. 3CYLCh. 24.3 - Physicians Assistants Another invertebrate animal...Ch. 24 - Prob. 1MCCh. 24 - Prob. 2MCCh. 24 - Prob. 3MCCh. 24 - Prob. 4MCCh. 24 - Prob. 5MCCh. 24 - __________ Animals obtain energy by __________;...Ch. 24 - Bilaterally symmetrical animals have __________...Ch. 24 - Animals that have an anterior and posterior end...Ch. 24 - Lophotrochozoans and ecdysozoans (molting animals)...Ch. 24 - Prob. 5FIBCh. 24 - Three major groups within the mollusks are the...Ch. 24 - Prob. 7FIBCh. 24 - For each of the following distinctive structures,...Ch. 24 - Prob. 1RQCh. 24 - Prob. 2RQCh. 24 - Briefly describe each of the following...Ch. 24 - Prob. 4RQCh. 24 - Prob. 5RQCh. 24 - Prob. 6RQCh. 24 - Prob. 7RQCh. 24 - Prob. 8RQCh. 24 - Insects are the largest group of animals on Earth....Ch. 24 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Developmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning


Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Phylogeny and the Tree of Life; Author: Professor Dave Explains;https://www.youtube.com/watch?v=KLMn4XwS8Tw;License: Standard YouTube License, CC-BY