
Human Biology: Concepts and Current Issues (8th Edition)
8th Edition
ISBN: 9780134042435
Author: Michael D. Johnson
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 24, Problem 9CR
Summary Introduction
To review:
The list of strategies that is in support of sustainable development.
Introduction:
The concept of sustainable development was first defined in 1987 by the world commission on environment and development. The term sustainable development is associated with the human development yet at the same time conserving the ecosystem and natural
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 24 Solutions
Human Biology: Concepts and Current Issues (8th Edition)
Ch. 24 - Do you think we should take action to reduce the...Ch. 24 - In what ways might your own lifestyle choices...Ch. 24 - Prob. 1CRCh. 24 - Prob. 2CRCh. 24 - Prob. 3CRCh. 24 - Explain how pollution can increase the greenhouse...Ch. 24 - Explain why tertiary consumers are more adversely...Ch. 24 - Compare and contrast the various sources of energy...Ch. 24 - Describe the importance of biodiversity and how...Ch. 24 - Prob. 8CR
Ch. 24 - Prob. 9CRCh. 24 - Global warming is most likely due to the impact of...Ch. 24 -
2. Which problem is attributed primarily to the...Ch. 24 - Which of the following is the primary source of...Ch. 24 - Which of the following are associated with the...Ch. 24 - Prob. 5TYCh. 24 - Prob. 6TYCh. 24 - Which of the following would be most affected by...Ch. 24 - All of the following are water pollutants except:...Ch. 24 - Which environmental issue is most closely...Ch. 24 - All of the following are examples or sources of...Ch. 24 - The energy source raising the least concerns of...Ch. 24 - Prob. 12TYCh. 24 - Prob. 13TYCh. 24 -
14. Which of the following is likely to be a...Ch. 24 -
15. All of the following are practices that...Ch. 24 - Prob. 1AWKCh. 24 - How can the seemingly simple choices a person...Ch. 24 - Prob. 3AWKCh. 24 - In the 1970s, the Black Forest of Germany...Ch. 24 -
5. During the 2008 summer Olympic Games in...Ch. 24 -
6. After Hurricane Katrina in 2005, many citizens...Ch. 24 - Many different energy sources can be used to...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Nitrogen emissions: environmental and health hazards; Author: Sandec Eawag;https://www.youtube.com/watch?v=iYcchHZ5Ejo;License: Standard Youtube License