BIOLOGY
12th Edition
ISBN: 9781260169614
Author: Raven
Publisher: RENT MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 24, Problem 3IQ
Summary Introduction
To determine: The findings of the gene transcription features in the genomes of apes and humans.
Introduction:
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is the answer to this question?
The figure below shows RNA-Seq data (RED) for the D. melanogaster transformer (tra) gene obtained from both adult female and male fruit flies.
The blue lines indicate the tra gene structure, with thicker lines indicating exons, and thin lines introns.
The 5' end of the gene is on the left, and the 3' end of the gene is on the right.
Based on these data, the most likely conclusion is:
Males and females express identical isoforms of tra
Males express more tra RNA than females
The female isoform has fewer amino acids
The female isoform has more amino acids
The male and female isoforms have different 3'UTRs
By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model.
You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos?
You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA?
5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’
3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’
After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…
Chapter 24 Solutions
BIOLOGY
Ch. 24.1 - Prob. 1LOCh. 24.1 - Prob. 2LOCh. 24.1 - Prob. 3LOCh. 24.2 - Prob. 1LOCh. 24.2 - Prob. 2LOCh. 24.2 - Prob. 3LOCh. 24.2 - Explain why genome size and genome number do not...Ch. 24.3 - Define the terms segmental duplication, genome...Ch. 24.3 - Prob. 2LOCh. 24.4 - Prob. 1LO
Ch. 24.4 - Prob. 2LOCh. 24.5 - Prob. 1LOCh. 24.5 - Prob. 2LOCh. 24.5 - Prob. 3LOCh. 24 - Prob. 1DACh. 24 - Prob. 1IQCh. 24 - Prob. 2IQCh. 24 - Prob. 3IQCh. 24 - Humans and pufferfish diverged from a common...Ch. 24 - Prob. 2UCh. 24 - Prob. 3UCh. 24 - Homologous genes in distantly related organisms...Ch. 24 - All of the following are believed to contribute to...Ch. 24 - What is the fate of most duplicated genes? a. Gene...Ch. 24 - Chimp and human DNA whole-genome sequences differ...Ch. 24 - Prob. 2ACh. 24 - Analyze the conclusion that the Medicago...Ch. 24 - Analyze why an herbicide that targets the...Ch. 24 - The FOX2 gene is associated with speech in human....Ch. 24 - One of the common misconceptions about sequencing...Ch. 24 - How does horizontal gene transfer (HGT) complicate...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Could quantitative PCR, which uses a DNA-binding dye, to show how many copies of the target DNA sequence could be used to quantify the amount of mRNA in a cell? Would you expect that a metabolically active tissue such as the liver would show more cDNA copies in such a method, compared to less metabolically active tissues such as skin cells? One reason that the types and amounts of mRNAs are quantified in different tissue types is to compare which genes are activated and which are inactive. It used to be thought that any gene that was transcribed was automatically translated. The discovery of RNA-degrading systems shows that the real situation in cells is more complemented. Do you believe that a larger amount of mRNA of a given type, say for alpha hemoglobin in immature red blood cells is a reliable indicator that more alpha hemoglobin protein will be made in those cells?arrow_forwardRNA are extracted from liver cells and separated in agarose gel by electrophoresis side-by-side with a molecular weight marker. The separated RNA fragments are then transferred to an RNA-binding membrane. Next, this membrane is incubated with labelled probe specific for the gene X. This experiment determines: MOLECULAR BIOLOGY_basic how many copies of gene X there are in liver cells. if the gene X is translated in liver cells. if gene X has a point mutation in liver cells. the chromosomal location of gene X. the length of the transcript of gene X.arrow_forwardDuring experimental RNAi, how does the researcher affect expression of a target gene? Group of answer choices Inject custom, lab-made double-stranded RNA into the specimen that will be targeted by the cell's existing Dicer to create siRNA complementary to the target gene's transcript. Inject lab-made Dicer proteins into the specimen which will cut up the target gene's transcript. Inject custom, lab-made siRNAs complementary to the target gene's transcript.arrow_forward
- Choose 1 or more than 1 RNA are extracted from liver cells and separated in agarose gel by electrophoresis side-by-side with a molecular weight marker. The separated RNA fragments are then transferred to an RNA-binding membrane. Next, this membrane is incubated with labelled probe specific for the gene X. This experiment determines: how many copies of gene X there are in liver cells. if the gene X is translated in liver cells. if gene X has a point mutation in liver cells. the chromosomal location of gene X. the length of the transcript of gene X.arrow_forwardResearchers have identified a gene (FR) responsible for watermelon resistance to infection by Dacus curcurbitae (a close relative of Drosophila melanogaster). They isolate RNA from resistant (FR+) and sensitive (fr-) watermelons and use a probe that will recognize both FR+ and fr- transcripts. They also isolate protein from resistant and sensitive watermelons and perform a Western blot using an antibody that can recognize the fr- and FR+ protein. Describe the results illustrated below and give a plausible molecular explanation for these observations.arrow_forwardWould gene chips containing bacterial DNA segments be useful for monitoring gene expression in a mammalian cell?arrow_forward
- For each of the following scenarios describing gene annotation, choose the answer that best fits A researcher searches a database of sequence motifs for matches to parts of a gene's sequence. A researcher searches for a genomic region that includes particular characteristics that include the following: a CpG island near a promoter, a TATA box and 5 and 3' splice sites. A researcher identifies genes based on known expression. Choose ab initio annotation in a eukaryotic genome ab initio annotation in a prokaryotic genome homology-based annotation ab initio annotation to investigate a gene's functionarrow_forwardYou are interested in finding out the function of a particular gene in the mouse genome. You have determined the nucleotide sequence of the gene, defined the portion that codes for its protein product, and searched the relevant database for similar sequences; however, neither the gene nor the encoded protein resembles anything previously described. What types of additional information about the gene and the encoded protein would you like to know in order to narrow down its function, and why?arrow_forwardAfter sequencing a new genome for the first time, functional protein-coding genes are initially identified by: BLAST searches that look for viral integration in the host genome Bioinformatic searches that reveal consensus sequences in expressed genes Aligning expressed exons sequenced from cDNA using transcriptomics B and C A and B Many regions of non-coding eukaryotic DNA previously thought to be "junk" are now known to contain sequence elements important to regulating gene expression. What approach can be used to identify important non-coding regulatory regions when annotating a newly sequenced genome? comparing cDNA to genomic DNA to validate that the gene is expressed identifying restriction enzyme recognition sequences in the genome phylogenetic footprinting to identify conserved non-coding sequences searching for start/stop codons and splice recognition sites that predict where a gene might be located…arrow_forward
- You obtained the sequence of the frog gene X you amplified in Question #16 through a process called automated sequencing. In automated sequencing, you are given a printout of the sense strand of your DNA. The printout is shown below. The first thing you need to do is use the correct reading frame. Having done this, the next thing to do is to write out the mRNA sequence using this sense strand reading frame. The last thing to do is to translate the sequence. Do these steps in the space below. The reading frame DNA sequence is: 2.The mRNA sequence is: The polypeptide sequence is:arrow_forwardA molecular geneticist hopes to find a gene gene in human liver cells that codes for an important blood clotting protein. He knows that the nucleotides sequence of a small part of the gene is GTGGACTGACA. briefly explain how to obtain the desired genearrow_forwardBefore this experiment, Dr Merrick didn’t know whether the OBP that he cloned was a type of myoglobin or hemoglobin from mammoth. From his data, he is now quite sure that OBP cannot be myoglobin from mammoth. How does he know? Explain your reasoning.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license