
A scientific claim can be defined as the statement that express the conclusion to a problem or an answer to a question that is being investigated. The data that support the scientific claims are known as the evidences. A claim is usually given as a short sentence in length and it should be specific. The answer to any question must be given completely.

Answer to Problem 1TQ
When evaluating a scientific claim, least consideration must be given to one’s own beliefs and values. The claim should be evaluated based on the data collected.
Therefore, option b is correct.
Explanation of Solution
Justify the reasons for the correct statement:
During the evaluation of a scientific claim, high importance must be given to scientific credentials, the type of journal in which the claim has published, whether the study supporting the claim meets the standards of scientific method, any possible preconceptions of the person making the claim.
Least considerations must be given to one’s own belief and thoughts because it can result in the wrong interpretation of data. This in turn results in wrong scientific claims.
Option (b) is given as, “Your personal beliefs and values”.
Hence, the option (b) is correct.
Justify the reasons for the incorrect statements:
Option (a) is given as, “the scientific credentials of the person making the claim”.
A credential is an evidence of qualification. The scientific credentials of the person who is making a claim must be given more consideration while evaluating a claim. This is because an accurate data can be collected by a person having appropriate credentials. Hence, it is a wrong answer.
Option (c) is given as, “whether the study supporting the claim has been published in a peer-reviewed scientific journal”.
Peer reviewed journals contain data which were validated and evaluated for suitability before publication. When evaluating a scientific claim, it is important to consider and to check whether the data supporting the claim has been published in a peer-reviewed scientific journal or not. Hence, it is a wrong answer.
Option (d) is given as, “whether the study supporting the claim meets the standards of the scientific method”.
The data that supports the claim must meet the standards of the scientific method during its evaluation. It must receive more consideration during the process. Hence, it is a wrong answer.
Option (e) is given as, “any possible biases of the person making the claim”.
Any possible biases or favoritism of the individual who is making the claim should be given high importance during the evaluation of the claim. This is because the person making the scientific claim can add additional information that will be useful to the public. Hence, it is a wrong answer.
Hence, options (a), (c), (d), and (e) are incorrect.
The person who is evaluating a scientific claim should give less consideration to his own beliefs and values while evaluating a scientific claim.
Want to see more full solutions like this?
Chapter 24 Solutions
Biology Now (Core Edition)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





