
Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
12th Edition
ISBN: 9780135755785
Author: Gerald Audesirk, Teresa Audesirk
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 23.2, Problem 1CYL
Summary Introduction
To describe:
The six main taxonomic groups of
Introduction:
Fungi are classified in kingdom Fungi which is separated from other kingdoms of plants and animals. This group includes eukaryotic organisms (unicellular organisms) like molds, yeast and other families of mushroom. Fungi are widely distributed and can reproduce in ranges of habitat from deep sea to deserts. They are known to be the decomposers of dead organic matter in an ecosystem.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 23 Solutions
Pearson eText Biology: Life on Earth with Physiology -- Instant Access (Pearson+)
Ch. 23.1 - Prob. 1TCCh. 23.1 - Prob. 1CYLCh. 23.1 - Prob. 2CYLCh. 23.2 - Prob. 1CSCCh. 23.2 - Prob. 1CYLCh. 23.2 - Prob. 2CYLCh. 23.3 - Fossil evidence suggests an important link between...Ch. 23.3 - Prob. 2TCCh. 23.3 - Prob. 1CYLCh. 23.3 - Prob. 2CYL
Ch. 23.4 - Prob. 1CSCCh. 23.4 - Prob. 1TCCh. 23.4 - Prob. 1HYEWCh. 23.4 - explain how fungi affect agriculture?Ch. 23.4 - Prob. 2CYLCh. 23.4 - describe the role of fungi in the production of...Ch. 23.4 - Prob. 1CTCh. 23 - Prob. 1MCCh. 23 - Which of the following diseases is not caused by a...Ch. 23 - A symbiotic association of plant roots and fungi...Ch. 23 - The alcohol in beer and wine is a by-product of...Ch. 23 - __________ is an ecologically important function...Ch. 23 - Prob. 1FIBCh. 23 - Prob. 2FIBCh. 23 - Prob. 3FIBCh. 23 - Prob. 4FIBCh. 23 - Prob. 5FIBCh. 23 - Prob. 6FIBCh. 23 - Prob. 1RQCh. 23 - Prob. 2RQCh. 23 - Prob. 3RQCh. 23 - Prob. 4RQCh. 23 - Prob. 5RQCh. 23 - Prob. 6RQCh. 23 - Describe how a fairy ring of mushrooms is...Ch. 23 - Prob. 8RQCh. 23 - Prob. 1ACCh. 23 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning


Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax