
Nester's Microbiology: A Human Perspective
9th Edition
ISBN: 9781259709999
Author: Denise G. Anderson Lecturer, Sarah Salm, Deborah Allen
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 23, Problem 8SA
Summary Introduction
To review:
The causative agent responsible for causing cat scratch disease and the reason that it is a threat to the patients with AIDS (acquired immunodeficiency syndrome).
Introduction:
Cat scratch disease is usually a benign kind of infectious disease, which is commonly found in the kids after the scratch or a bite from the cat. The infection grows within 2 to 14 days and it is characterized as a bacterial infection, which affects the lymph nodes that are needed to drain the sites of inoculation.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?
Chapter 23 Solutions
Nester's Microbiology: A Human Perspective
Ch. 23 - What property of Staphylococcus epidermidis helps...Ch. 23 - Prob. 2SACh. 23 -
3. Name two underlying conditions that predispose...Ch. 23 - Give two sources of Pseudomonas aeruginosa.Ch. 23 -
5. Outline the pathogenesis of tetanus.
Ch. 23 -
6. Explain why C. tetani can be cultivated from...Ch. 23 - Prob. 7SACh. 23 - Prob. 8SACh. 23 -
9. What is a synergistic infection? How might one...Ch. 23 - Why is sporotrichosis sometimes called rose...
Ch. 23 - Which of the following about Staphylococcus aureus...Ch. 23 - Prob. 2MCCh. 23 - Prob. 3MCCh. 23 - Prob. 4MCCh. 23 - Prob. 5MCCh. 23 - Prob. 6MCCh. 23 - Prob. 7MCCh. 23 - Prob. 8MCCh. 23 - Prob. 9MCCh. 23 - Prob. 10MCCh. 23 - Prob. 1ACh. 23 -
2. An army field nurse working at a mobile...Ch. 23 -
1. In what way would the incidence of tetanus at...Ch. 23 - Prob. 2CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Developmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forwardBiology How would you make 1 L of 0.5X TBE buffer using5X TBE buffer solution and distilled water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningSurgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:Cengage

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage