PRESCOTT'S MICROBIOLOGY
11th Edition
ISBN: 2818440045677
Author: WILLEY
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 23, Problem 3AL
Summary Introduction
The genus Streptomyces is classified under the order of Streptomycetales. Chains of spores (3 to 50) or even more exospores are produced by these bacteria. These bacteria are of high importance in medicine because they produce antibiotics, antifungal and anticancer agents.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
You are studying the M-cyclin. You treat mitotic cells with an inhibitor of the
proteasome and find that M-cyclin is no longer degraded and that this prolongs
mitosis. You also find that in the presence of the inhibitor, M-cyclin is now running
slower/larger in a Western than you have previously observed. In 1-2 sentences,
explain why this might be happening.
Edit View Insert Format Tools Table
12pt Paragraph B IU Αν
S
A
C
I
AT²✓
#tv A
MacBook Air
X
:
G
Yeast cells are eukaryotes, and they require a functional secretory pathway to grow
and to maintain cellular organization. But surprisingly, when SRP is removed from
yeast cells by deleting the relevant genes, the cells are still alive (although they grow
slowly).
a) How can yeast survive without SRP? Propose two alternative hypotheses.
b) How might electron microscopy of normal and SRP-deficient yeast cells help you
to distinguish between these two hypotheses?
14) Why are telomeres so important in eukaryotic organisms?
A) Without telomeres, important DNA could be lost every time the cell divides.
B) They cap the mRNA, allowing it to pass through the nuclear membrane to the cytoplasm fo
translation.
C) They provide a repetitive DNA sequence needed by primers to recognize the beginning of
transcription.
D) They remain relatively undamaged from environmental stress and toxins.
Chapter 23 Solutions
PRESCOTT'S MICROBIOLOGY
Ch. 23.1 - MICRO INQUIRY Refer to table 24.2 and determine...Ch. 23.1 - MICRO INQUIRY Why do Mycobacterium spp. have...Ch. 23.1 - Prob. 3MICh. 23.1 - Prob. 1.1CCCh. 23.1 - Prob. 1.2CCCh. 23.1 - Retrieve, Infer, Apply Why are actinobacteria of...Ch. 23.1 - Prob. 1.4CCCh. 23.1 - Retrieve, Infer, Apply Compare the morphology and...Ch. 23.1 - Prob. 1.6CCCh. 23.1 - Prob. 1.7CC
Ch. 23.1 - Prob. 1.8CCCh. 23.1 - Retrieve, Infer, Apply List the distinguishing...Ch. 23.1 - Prob. 2.2CCCh. 23.1 - Prob. 2.3CCCh. 23.1 - Retrieve, Infer, Apply Describe three ways in...Ch. 23.1 - Briefly describe the defining properties of genera...Ch. 23.1 - Prob. 2.6CCCh. 23.1 - Examine the ingredients list on a commercial...Ch. 23.2 - What growth or survival advantage might this type...Ch. 23.2 - What is the net yield of ATP for each glucose that...Ch. 23.2 - Prob. 3MICh. 23.2 - Prob. 1CCCh. 23.2 - Prob. 2CCCh. 23.2 - Prob. 3CCCh. 23.2 - Prob. 4CCCh. 23.2 - How are various species of Streptococcus...Ch. 23.2 - Of what practical importance are leuconostocs?...Ch. 23.2 - What is the difference between -hemolysis and...Ch. 23.3 - The presence of an electron transport chain in a...Ch. 23.3 - In addition to its Gram-staining characteristics,...Ch. 23.3 - What are the two sources of electrons for the H....Ch. 23.4 - Prob. 1CCCh. 23.4 - Suggest why C. tetani uses a sodium motive force...Ch. 23.4 - Prob. 3CCCh. 23.4 - What kind of genetic evidence, in addition to 16S...Ch. 23 - Prob. 1RCCh. 23 - Prob. 2RCCh. 23 - Prob. 3RCCh. 23 - Prob. 4RCCh. 23 - Prob. 5RCCh. 23 - Prob. 6RCCh. 23 - Prob. 7RCCh. 23 - Prob. 8RCCh. 23 - Prob. 9RCCh. 23 - Prob. 10RCCh. 23 - Even though actinobacteria are high G + C...Ch. 23 - Given that mycolic acids are essential for...Ch. 23 - Prob. 3ALCh. 23 - Prob. 4ALCh. 23 - Prob. 5ALCh. 23 - What physiological properties might account for...Ch. 23 - S. aureus strains that are resistant to...Ch. 23 - Prob. 8AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'arrow_forwardBriefly describe how a phosphorelay system and sigma factors are used to control sporulation in B. subtilis. Give one example of posttranslational modification as a means to regulate this process.arrow_forwardThe figure below shows the life cycle of the fungus Neurospora. The adult stage of the Neurospora is a multicellular haploid. b) Neurospora has an arginine amino acid synthesis pathway shown below. Suppose I take the strain above that only grows with arginine supplements and cross it to a different mutant Neurospora strain that grows with arginine and citrulline supplements but not with ornithine supplements. Assuming gens A, B, and C are unlinked and there is only one mutation per stain: What percentage of the progeny will grow on ornithine? What percentage on citrulline? What percentage on arginine?arrow_forward
- You are working in a lab studying Progeria. You design an expression vector containing a mutated form of the lamin gene that codes for a lamin protein that can no longer be phosphorylated. What do you predict would happen if you express this mutant form of lamin in a cell line? Lamin proteins would not be transported into the nucleus and would remain in the cytosol. Nuclear lamins will be unable to produce dimers, as the coiled-coil formation will be disrupted. Disassembly of the nuclear lamins will occur prematurely. Nuclear lamins will no longer disassemble properly during prometaphase. O Nuclear lamins will no longer assemble properly during telophase.arrow_forwardThree different chitin synthase genes control chitin synthesis in S. cerevisiae. Discuss what will happen to the budding yeast if a mutation occurs in each of the genes below: CHSI CHSII CHSIIIarrow_forwardPlease explain how alternative gene expression is mediated by a recombination process in Salmonella? Please explain why does Salmonella use recombination-mediated alternative gene expression?arrow_forward
- Repressors are inactivated either by interaction with a small-molecule inducer or by proteolytic cleavage. Why is it advantageous for a repressor like the lac repressor to be inactivated by binding to allolactose rather than by proteolytic cleavage?arrow_forwardA gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr. A mutation in this gene has a G inserted after the second C in the strand. How will this mutation affect the phenotype? A)This will affect the phenotype because although most of the protein will be identical, the first amino acid will be different. B)This will not affect the phenotype because only the second amino acid is different from the original protein. C)This will not affect the phenotype because the protein will be identical to the original protein. D)This will affect the phenotype because all of the amino acids after the first one will be different from the original protein.arrow_forwardDescribe the function of the Bicoid protein. Explain how its ability to exert its effects in a concentration-dependent manner is a critical feature of its function.arrow_forward
- A full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete promoter sequence and a functional polyadenylation sequence, and it has wild-type nucleotides throughout the transcribed region. However, the gene fails to produce a functional protein. a)List at least 3 possible reasons why this eukaryotic gene is not expressed in bacteria. b)What changes would you recommend to permit expression of this eukaryotic gene in a bacterial cell?arrow_forwardThe figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides.arrow_forwardThe figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides. 99 62 120 84 102 27 117 Gene X E1 11 E2 12 ЕЗ 13 E4 Exon (E) Intron (I)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Cell Differentiation | Genetics | Biology | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=gwAz_BtVuLA;License: Standard YouTube License, CC-BY