
Visual Anatomy & Physiology Plus Mastering A&P withPearson eText -- Access Card Package (3rd Edition) (New A&P Titles by Ric Martini and Judi Nath)
3rd Edition
ISBN: 9780134396408
Author: Frederic H. Martini, William C. Ober, Judi L. Nath, Edwin F. Bartholomew, Kevin F. Petti
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 2.3, Problem 20SR
Summary Introduction
To describe: The reason why the addition of table salt to pure water does not result in change in its pH.
Introduction: Water is the essential element of the human body, which accounts for 60% of the total body weight. A water molecule is shaped like a ‘V’ and consists of an oxygen atom and two hydrogen atoms.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
7. Aerobic respiration of a protein that breaks down into 12 molecules of malic acid. Assume there is no
other carbon source and no acetyl-CoA.
NADH
FADH2
OP ATP
SLP ATP
Total ATP
Show your work using dimensional analysis here:
3
For each of the following problems calculate the following: (Week 6-3 Video with 6-1 and 6-2)
Consult the total catabolic pathways on the last page as a reference for the following questions.
A. How much NADH and FADH2 is produced and fed into the electron transport chain (If any)?
B. How much ATP is made from oxidative phosphorylation (OP), if any? Feed the NADH and FADH2 into the
electron transport chain: 3ATP/NADH, 2ATP/FADH2
C. How much ATP is made by substrate level phosphorylation (SLP)?
D. How much total ATP is made? Add the SLP and OP together.
1. Aerobic respiration using 0.5 mole of glucose?
NADH
FADH2
OP ATP
SLP ATP
Total ATP
Show your work using dimensional analysis here:
Aerobic respiration of one lipid molecule. The lipid is composed of one glycerol molecule connected to two
fatty acid tails. One fatty acid is 12 carbons long and the other fatty acid is 18 carbons long in the figure
below. Use the information below to determine how much ATP will be produced from the glycerol part of
the lipid. Then, in part B, determine how much ATP is produced from the 2 fatty acids of the lipid. Finally
put the NADH and ATP yields together from the glycerol and fatty acids (part A and B) to determine your
total number of ATP produced per lipid. Assume no other carbon source is available.
18 carbons
fatty acids
12 carbons
glycerol
. Glycerol is broken down to glyceraldehyde 3-phosphate, a glycolysis intermediate via the following
pathway shown in the figure below. Notice this process costs one ATP but generates one FADH2. Continue
generating ATP with glyceraldehyde-3-phosphate using the standard pathway and aerobic respiration.
glycerol
glycerol-3-
phosphate…
Chapter 2 Solutions
Visual Anatomy & Physiology Plus Mastering A&P withPearson eText -- Access Card Package (3rd Edition) (New A&P Titles by Ric Martini and Judi Nath)
Ch. 2.1 - Prob. 1RCh. 2.1 - Prob. 2RCh. 2.1 - Prob. 3RCh. 2.1 - Prob. 4RCh. 2.1 - Prob. 5RCh. 2.1 - Prob. 6RCh. 2.1 - Explain why the atoms of inert elements do not...Ch. 2.1 - Prob. 8RCh. 2.1 - Prob. 9RCh. 2.1 - Prob. 10R
Ch. 2.1 - Prob. 11RCh. 2.1 - Prob. 12RCh. 2.1 - Prob. 13RCh. 2.1 - Prob. 14RCh. 2.1 - Prob. 1LOCh. 2.1 - Prob. 2LOCh. 2.1 - Explain the relationship between electrons and...Ch. 2.1 - Prob. 4LOCh. 2.1 - Prob. 5LOCh. 2.1 - Prob. 1ICh. 2.1 - Prob. 2ICh. 2.1 - Prob. 3ICh. 2.1 - Prob. 4ICh. 2.1 - Prob. 5ICh. 2.1 - Matching: Match each lettered term with the most...Ch. 2.1 - Prob. 2SRCh. 2.1 - Prob. 3SRCh. 2.1 - Matching: Match each lettered term with the most...Ch. 2.1 - Matching: Match each lettered term with the most...Ch. 2.1 - Prob. 6SRCh. 2.1 - Matching: Match each lettered term with the most...Ch. 2.1 - Matching: Match each lettered term with the most...Ch. 2.1 - Matching: Match each lettered term with the most...Ch. 2.1 - Matching: Match each lettered term with the most...Ch. 2.1 - Prob. 11SRCh. 2.1 - Prob. 12SRCh. 2.1 - Fill-in: Fill in the missing information in the...Ch. 2.1 - Indicate which of the following molecules are also...Ch. 2.1 - Indicate which of the following molecules are also...Ch. 2.1 - Indicate which of the following molecules are also...Ch. 2.1 - Prob. 26SRCh. 2.1 - Section integration: Describe how the following...Ch. 2.1 - Section integration: Describe how the following...Ch. 2.1 - Section integration: Describe how the following...Ch. 2.2 - Prob. 1RCh. 2.2 - Prob. 2RCh. 2.2 - Prob. 3RCh. 2.2 - Prob. 4RCh. 2.2 - Prob. 5RCh. 2.2 - Prob. 6RCh. 2.2 - Prob. 7RCh. 2.2 - Prob. 8RCh. 2.2 - Prob. 9RCh. 2.2 - Prob. 1LOCh. 2.2 - Use chemical notation to symbolize chemical...Ch. 2.2 - Prob. 3LOCh. 2.2 - Describe the crucial role of enzymes in...Ch. 2.2 - Prob. 1ICh. 2.2 - C. What is the source of energy that converts...Ch. 2.2 - Prob. 3ICh. 2.2 - Prob. 1SRCh. 2.2 - Prob. 2SRCh. 2.2 - Prob. 3SRCh. 2.2 - Prob. 4SRCh. 2.2 - Prob. 5SRCh. 2.2 - Prob. 6SRCh. 2.2 - Prob. 7SRCh. 2.2 - Prob. 8SRCh. 2.2 - Prob. 9SRCh. 2.2 - Prob. 10SRCh. 2.2 - Prob. 11SRCh. 2.2 - Prob. 12SRCh. 2.2 - Prob. 13SRCh. 2.2 - Prob. 14SRCh. 2.2 - Prob. 15SRCh. 2.2 - Prob. 16SRCh. 2.3 - Prob. 1RCh. 2.3 - Prob. 2RCh. 2.3 - Prob. 3RCh. 2.3 - Prob. 4RCh. 2.3 - Prob. 5RCh. 2.3 - Prob. 1LOCh. 2.3 - Prob. 2LOCh. 2.3 - Prob. 3LOCh. 2.3 - Prob. 1ICh. 2.3 - Prob. 2ICh. 2.3 - Prob. 3ICh. 2.3 - Prob. 1SRCh. 2.3 - Prob. 2SRCh. 2.3 - Prob. 3SRCh. 2.3 - Prob. 4SRCh. 2.3 - Prob. 5SRCh. 2.3 - Prob. 6SRCh. 2.3 - Prob. 7SRCh. 2.3 - Prob. 8SRCh. 2.3 - Prob. 9SRCh. 2.3 - Prob. 10SRCh. 2.3 - Prob. 11SRCh. 2.3 - Prob. 12SRCh. 2.3 - Prob. 13SRCh. 2.3 - Prob. 14SRCh. 2.3 - Prob. 15SRCh. 2.3 - Prob. 16SRCh. 2.3 - Prob. 17SRCh. 2.3 - Prob. 18SRCh. 2.3 - Prob. 19SRCh. 2.3 - Prob. 20SRCh. 2.4 - Prob. 1RCh. 2.4 - Prob. 2RCh. 2.4 - Prob. 3RCh. 2.4 - Prob. 4RCh. 2.4 - Describe the structures of saturated and...Ch. 2.4 - Prob. 6RCh. 2.4 - Prob. 7RCh. 2.4 - Prob. 8RCh. 2.4 - Prob. 9RCh. 2.4 - Prob. 10RCh. 2.4 - Prob. 11RCh. 2.4 - Prob. 12RCh. 2.4 - Prob. 13RCh. 2.4 - Prob. 14RCh. 2.4 - Prob. 15RCh. 2.4 - Prob. 16RCh. 2.4 - Prob. 1LOCh. 2.4 - Discuss the structures and functions of...Ch. 2.4 - Prob. 3LOCh. 2.4 - Prob. 4LOCh. 2.4 - Discuss protein structure and the essential...Ch. 2.4 - Prob. 6LOCh. 2.4 - Prob. 7LOCh. 2.4 - Prob. 8LOCh. 2.4 - Prob. 1ICh. 2.4 - Prob. 2ICh. 2.4 - Prob. 3ICh. 2.4 - Prob. 4ICh. 2.4 - Prob. 5ICh. 2.4 - Prob. 6ICh. 2.4 - Prob. 7ICh. 2.4 - Concept map: Use each of the following terms once...Ch. 2.4 - Prob. 16SRCh. 2.4 - Prob. 17SRCh. 2.4 - Prob. 18SRCh. 2.4 - Prob. 19SRCh. 2.4 - Prob. 20SRCh. 2.4 - Prob. 21SRCh. 2.4 - Prob. 22SRCh. 2.4 - Prob. 23SRCh. 2.4 - Prob. 24SRCh. 2.4 - Prob. 25SRCh. 2.4 - Prob. 26SRCh. 2.4 - Prob. 27SRCh. 2.4 - Prob. 28SRCh. 2.4 - Prob. 29SRCh. 2.4 - Prob. 30SRCh. 2 - Prob. 1CRQCh. 2 - Prob. 2CRQCh. 2 - Prob. 3CRQCh. 2 - Prob. 4CRQCh. 2 - Prob. 5CRQCh. 2 - Prob. 6CRQCh. 2 - Prob. 7CRQCh. 2 - Prob. 8CRQCh. 2 - Prob. 9CRQCh. 2 - Prob. 10CRQCh. 2 - Prob. 11CRQCh. 2 - Prob. 12CRQCh. 2 - All the chemical reactions that occur in the human...Ch. 2 - Prob. 14CRQCh. 2 - Prob. 15CRQCh. 2 - Prob. 16CRQCh. 2 - Prob. 17CRQCh. 2 - Prob. 18CRQCh. 2 - Prob. 19CRQCh. 2 - Prob. 20CRQCh. 2 - Prob. 21CRQCh. 2 - Prob. 22CRQCh. 2 - Prob. 23CRQCh. 2 - Prob. 24CRQCh. 2 - Prob. 25CRQCh. 2 - Prob. 26CRQCh. 2 - Prob. 27CRQCh. 2 - Prob. 28CRQCh. 2 - Prob. 29CRQCh. 2 - Prob. 30CRQCh. 2 - Prob. 1CICh. 2 - Prob. 2CICh. 2 - Prob. 3CICh. 2 - Prob. 4CI
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Don't copy the other answerarrow_forward4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is equivalent to acetyl-CoA. NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here: 5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source. NADH FADH2 OP ATP Show your work using dimensional analysis here: SLP ATP Total ATParrow_forwardBiology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forward
- Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forward
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
GCSE Chemistry - Acids and Bases #34; Author: Cognito;https://www.youtube.com/watch?v=vt8fB3MFzLk;License: Standard youtube license