
Concept explainers
The plant bodies are made up of three types of essential tissues, namely ground, vascular, and dermal tissues. The ground tissues make up the majority of plant body, and contribute in wound repair and photosynthesis. The dermal tissues regulate the flow of

Answer to Problem 1TQ
The water is transported through the plant body by xylem. Therefore, option (a) is correct.
Explanation of Solution
Justify the reasons for the correct statement:
A type of vascular tissue present all over the body of the plant is called as the xylem. The essential function of the xylem is to transport water from the roots to different parts of the plant shoots system, such as stems and leaves. It also involved in transporting nutrients.
Option (a) is given as, “xylem”.
Hence, option (a) is correct.
Justify the reasons for the incorrect statements:
Option (b) is given as, “phloem”.
The phloem is the living tissue involved in transporting the soluble organic compounds that are made during the photosynthesis. The specialized cells present in the phloem helps to transport sugar such as sucrose. Thus, the phloem is a food conducting tissue that is not involved in the transport of water. Hence, it is a wrong answer.
Option (c) is given as, “stomata”.
The pore found in the epidermis of stems, leaves, and other organs are called as stomata. It mainly facilitates the gaseous exchange during transpiration. The stomata does not transport the water. Hence, it is a wrong answer.
Option (d) is given as, “root hairs”.
Root hair is a tube-like outgrowth of a trichoblast. The root hairs increase the surface area of absorption. It is not involved in transporting the water. Hence, it is a wrong answer.
Option (e) is given as, “flowers”.
The flowers are the reproductive structure present in the flowering plants. The natural function of the flower is reproduction. The water is not transported by the flowers. Hence, it is a wrong answer.
Hence, options (b), (c), (d), and (e) are incorrect.
Therefore, the xylem facilitates the transport of water and nutrients in the upward direction to different parts of the plant body.
Want to see more full solutions like this?
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





