HUMAN ANA.+PHYS.W/LAB MANUAL >BCI<
19th Edition
ISBN: 9780135672990
Author: AMERMAN
Publisher: Pearson Custom Publishing
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 2.3, Problem 1QC
Summary Introduction
To review:
The relationship between kinetic and potential energy.
Introduction:
Matter and energy are the two most important concepts of science. Matter is an entity of the environment. It can either be biotic or abiotic. Energy can be defined as the capacity of matter to do work. Energy can be broadly classified into kinetic energy and potential energy. The net flow of energy in the system remains conserved.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 2 Solutions
HUMAN ANA.+PHYS.W/LAB MANUAL >BCI<
Ch. 2.1 - What are atoms?Ch. 2.1 - How do the three types of subatomic particles...Ch. 2.1 - What is an element?Ch. 2.1 - 4. How are elements arranged in the periodic...Ch. 2.1 - What are isotopes?Ch. 2.2 - What is a mixture?Ch. 2.2 - 2. How do the three types of mixtures differ?
Ch. 2.2 - Prob. 3QCCh. 2.2 - What is an ionic bond?Ch. 2.2 - 5. How is an ionic bond formed?
Ch. 2.2 - 6. How do polar and nonpolar covalent bonds...Ch. 2.2 - What are hydrogen bonds? Between which types of...Ch. 2.3 - Prob. 1QCCh. 2.3 - What are the differences between the three types...Ch. 2.3 - How do endergonic and exergonic reactions differ?Ch. 2.3 - 4. What are the differences between the three main...Ch. 2.3 - What factors can influence the rate of a chemical...Ch. 2.3 - 6. What is an enzyme, and what is its function?
Ch. 2.4 - What four properties of water make it a good...Ch. 2.4 - 2. Which molecules or compounds are likely to be...Ch. 2.4 - What are acids and bases?Ch. 2.4 - What is the pH scale? Which pH values are...Ch. 2.4 - What is the effect of a buffer on a solution?Ch. 2.4 - What is a salt?Ch. 2.4 - 7. What does an electrolyte do in a solution?
Ch. 2.5 - 1. How do polymers and monomers differ?
Ch. 2.5 - 2. How do monosaccharides, disaccharides, and...Ch. 2.5 - How are two monosaccharides linked to form a...Ch. 2.5 - Prob. 4QCCh. 2.5 - 5. How do phospholipids and triglycerides differ?
Ch. 2.5 - What are steroids?Ch. 2.5 - Prob. 7QCCh. 2.5 - How are amino acids linked to form peptides and...Ch. 2.5 - 9. What are the four levels of structural...Ch. 2.5 - 10. What are the components and roles of ATP?
Ch. 2.5 - 11. How do DNA and RNA differ?
Ch. 2 - Prob. 1CYRCh. 2 - Fill in the blanks: Isotopes are atoms with the...Ch. 2 - 3. Which of the following statements correctly...Ch. 2 - 4. Explain the difference between an ionic and a...Ch. 2 - Identify each of the following molecules or...Ch. 2 - What are hydrogen bonds, and how do they form?Ch. 2 - Prob. 7CYRCh. 2 - Prob. 8CYRCh. 2 - Which of the following would not result in an...Ch. 2 - 10. An enzyme is a:
a. biological catalyst that...Ch. 2 - Prob. 11CYRCh. 2 - With respect to their solubility in water,...Ch. 2 - Mark the following statements as true or false. If...Ch. 2 - A salt is: a. a metal cation bonded to a nonmetal...Ch. 2 - 15. Compare and contrast the structures of...Ch. 2 - 16. Mark the following statements as true or...Ch. 2 - 17. Why is it important for a protein to maintain...Ch. 2 - Which of the following is not part of a...Ch. 2 - 19. Mark the following properties as belonging to...Ch. 2 - Which of the following statements is/are true...Ch. 2 - 1. In certain types of radioactive decay, the...Ch. 2 - Considering that water is a main component of the...Ch. 2 - 3. Explain why monosaccharides are polar and fatty...Ch. 2 - 1. The polysaccharide cellulose is not digestible...Ch. 2 - Some claim that the pH of your blood can be...Ch. 2 - Prob. 3AYKACh. 2 - Prob. 4AYKB
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning