BIOLOGY:ESSENTIALS NSU- CONNECT
3rd Edition
ISBN: 9781265145125
Author: Hoefnagels
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 22, Problem 4MCQ
Summary Introduction
Introduction:
The fusion of one haploid sperm nucleus with the central cell’s two nuclei produces a tissue known as endosperm. It is a triploid structure that is formed at the time of double fertilization.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?
The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?
Chapter 22 Solutions
BIOLOGY:ESSENTIALS NSU- CONNECT
Ch. 22.1 - What adaptations contribute to the reproductive...Ch. 22.1 - Prob. 2MCCh. 22.1 - Prob. 3MCCh. 22.2 - Label as many flower parts as possible in the...Ch. 22.2 - How does pollen move from one flower to another,...Ch. 22.2 - Prob. 3MCCh. 22.2 - Prob. 4MCCh. 22.2 - Prob. 5MCCh. 22.2 - Prob. 6MCCh. 22.2 - Prob. 7MC
Ch. 22.3 - Prob. 1MCCh. 22.3 - Prob. 2MCCh. 22.3 - Prob. 3MCCh. 22.4 - Prob. 1MCCh. 22.4 - Prob. 2MCCh. 22.4 - List the major classes of plant hormones, and name...Ch. 22.4 - Prob. 4MCCh. 22.5 - Prob. 1MCCh. 22.5 - How does light help regulate flowering time?Ch. 22.6 - Prob. 1MCCh. 22.6 - Prob. 2MCCh. 22 - The new gene combinations associated with sexual...Ch. 22 - Prob. 2MCQCh. 22 - Where would you find a male gametophyte? a. Inside...Ch. 22 - Prob. 4MCQCh. 22 - Prob. 5MCQCh. 22 - Prob. 6MCQCh. 22 - Prob. 7MCQCh. 22 - 8. What type of tropism is adaptive to a...Ch. 22 - Prob. 1WIOCh. 22 - Prob. 2WIOCh. 22 - Prob. 3WIOCh. 22 - Prob. 4WIOCh. 22 - Prob. 5WIOCh. 22 - Prob. 6WIOCh. 22 - Prob. 7WIOCh. 22 - Prob. 8WIOCh. 22 - Prob. 9WIOCh. 22 - Prob. 10WIOCh. 22 - Prob. 11WIOCh. 22 - What is the function of photoreceptors?Ch. 22 - Prob. 13WIOCh. 22 - Prob. 14WIOCh. 22 - Prob. 15WIOCh. 22 - Prob. 16WIOCh. 22 - Prob. 1SLCh. 22 - Prob. 1PITCh. 22 - Prob. 2PITCh. 22 - Prob. 3PITCh. 22 - Prob. 4PIT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
- Biology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forwardBiology How would you make 1 L of 0.5X TBE buffer using5X TBE buffer solution and distilled water?arrow_forwardUnit Conversions: If the field of view at 10x is 3.1x106 µm2, what would it be in mm2. Report your answer with 2 significant digits. 1 mm = 1000 µm. Include units in your answer.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning


Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Plant Reproduction in Angiosperms; Author: Amoeba Sisters;https://www.youtube.com/watch?v=HLYPm2idSTE;License: Standard YouTube License, CC-BY