The fusion of one haploid sperm nucleus with the central cell’s two nuclei produces a tissue known as endosperm. It is a triploid structure that is formed at the time of double fertilization.

Question

Want to see the full answer?

Answer 1

Question

Chapter 22, Problem 4MCQ

Summary Introduction

Introduction:

The fusion of one haploid sperm nucleus with the central cell’s two nuclei produces a tissue known as endosperm. It is a triploid structure that is formed at the time of double fertilization.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?

Answer 2

Question

Chapter 22, Problem 4MCQ

Summary Introduction

Introduction:

The fusion of one haploid sperm nucleus with the central cell’s two nuclei produces a tissue known as endosperm. It is a triploid structure that is formed at the time of double fertilization.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 22, Problem 4MCQ

Summary Introduction

Introduction:

The fusion of one haploid sperm nucleus with the central cell’s two nuclei produces a tissue known as endosperm. It is a triploid structure that is formed at the time of double fertilization.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 22, Problem 4MCQ

Summary Introduction

Introduction:

The fusion of one haploid sperm nucleus with the central cell’s two nuclei produces a tissue known as endosperm. It is a triploid structure that is formed at the time of double fertilization.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 22, Problem 4MCQ

Summary Introduction

Introduction:

The fusion of one haploid sperm nucleus with the central cell’s two nuclei produces a tissue known as endosperm. It is a triploid structure that is formed at the time of double fertilization.

Answer 6

Chapter 22, Problem 4MCQ

Summary Introduction

Introduction:

The fusion of one haploid sperm nucleus with the central cell’s two nuclei produces a tissue known as endosperm. It is a triploid structure that is formed at the time of double fertilization.

Answer 7

Chapter 22, Problem 4MCQ

Summary Introduction

Introduction:

The fusion of one haploid sperm nucleus with the central cell’s two nuclei produces a tissue known as endosperm. It is a triploid structure that is formed at the time of double fertilization.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 22.1 - What adaptations contribute to the reproductive...Ch. 22.1 - Prob. 2MC Ch. 22.1 - Prob. 3MC Ch. 22.2 - Label as many flower parts as possible in the...Ch. 22.2 - How does pollen move from one flower to another,...Ch. 22.2 - Prob. 3MC Ch. 22.2 - Prob. 4MC Ch. 22.2 - Prob. 5MC Ch. 22.2 - Prob. 6MC Ch. 22.2 - Prob. 7MC

The fusion of one haploid sperm nucleus with the central cell’s two nuclei produces a tissue known as endosperm. It is a triploid structure that is formed at the time of double fertilization.

Solution Summary: The author explains that the endosperm develops inside the seed because it produces its own nutrients as it divides.

Concept explainers

Videos

Introduction:

The fusion of one haploid sperm nucleus with the central cell’s two nuclei produces a tissue known as endosperm. It is a triploid structure that is formed at the time of double fertilization.

Want to see the full answer?

Chapter 22 Solutions

The fusion of one haploid sperm nucleus with the central cell’s two nuclei produces a tissue known as endosperm. It is a triploid structure that is formed at the time of double fertilization.

Solution Summary: The author explains that the endosperm develops inside the seed because it produces its own nutrients as it divides.

Concept explainers

Videos

Introduction: The fusion of one haploid sperm nucleus with the central cell’s two nuclei produces a tissue known as endosperm. It is a triploid structure that is formed at the time of double fertilization.

Want to see the full answer?

Chapter 22 Solutions

Introduction:

The fusion of one haploid sperm nucleus with the central cell’s two nuclei produces a tissue known as endosperm. It is a triploid structure that is formed at the time of double fertilization.