
To determine: The way by which cancer cells are structurally different from normal cells of the same tissue.
Introduction: Cancer is caused due to abnormal cell growth. This occurs due to several genetic and epigenetic alterations that cause uncontrolled proliferation of cells. The word tumor is used to refer swelling, but now it is used to describe the new growth or neoplasm (cancerous growth). The clinical manifestations of cancer are numerous and depend on the variety and intensity of symptoms.

Explanation of Solution
The structural difference between the normal cells and cancer cells are as follows:
Characteristics | Normal cells | Cancer cells |
Shape of cells | Normal and regular cell | Irregular |
Nucleus | Proportionate size | Enlarged and darker nuclei |
Cytoplasm | Normal | Little cytoplasm |
Cytoskeleton | Normal | Changes occur in cytoskeletal structure |
Plasma membrane | Normal | Changes occur in plasma membrane |
Growth | In control | Uncontrolled growth |
Contact inhibition | present | Absent |
Mortality | Mortal; through apoptosis | Immortal |
Maturation of cells | Matures and undergo cell differentiation | Undifferentiated |
To determine: The relevance of altered surface proteins to uncontrolled growth.
Introduction: Cancer is caused due to abnormal cell growth. This occurs due to several genetic and epigenetic alterations that cause uncontrolled proliferation of cells. The word tumor is used to refer swelling, but now it is used to describe the new growth or neoplasm (cancerous growth). The clinical manifestations of cancer are numerous and depend on the variety and intensity of symptoms.

Explanation of Solution
Some tumor or cancer cells do not express the antigens over their surface that causes failure in eliciting the immune response of the body. Altered expression of surface proteins of cells leads to the undesired changes in the cell interaction to its environment and response of surrounding cells. These cells divide rapidly and lose contact inhibition.
Cancer cells keep on growing beyond a monolayer and form a mass of cells that overlap with each other. They do not show anchorage-dependent growth. For a normal cell, cell division is limited to a monolayer. They stop cell division after forming a monolayer. Their growth is halted by contacts with neighboring cells as well as the availability of growth factors, nutrients, and substratum. After losing contact inhibition, the cell ceases to adhere within the tissue, which allows it to move away from the site of the original neoplasm.
Want to see more full solutions like this?
Chapter 22 Solutions
EBK HUMAN BIOLOGY
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningSurgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College




