
To compare:
The characteristics of different divisions of seed plants by completing the given table
Introduction: Plant kingdom can be classified into vascular and nonvascular plants. Vascular plants can be further classified as seedless and seed plants. Seed plants include Cycadophyta, Gingkophyta, Gnetophyta, Conierophyta and Anthophyta.

Answer to Problem 4MI
Reproduction | Environment | Examples | |
Cycadophyta | Males produce pollen grains from cones, pollen produce motile sperm | Tropics and sub tropics | There are about 100 species today |
Gingkophyta | Males produce pollen grains from cones, pollen produce motile sperm | China, Male gingkoes planted in cities as they can tolerate smog and pollution | Gingko biloba |
Gnetophyta | None given | Deserts and mountains of Asia, Africa, North America, Central or South America | Tropical climbing plants and shrub like plants |
Conierophyta | Reproductive parts produced in cones | Temperate forests | Fir, spruce, pine, cedar, juniper, redwood, larch |
Anthophyta | Seeds enclosed in a fruit | Variety of environments | Fruit trees |
Explanation of Solution
Cycadophyta- Cones contain male or female reproductive structures of cycads. Plants with cones evolved before plants with flowers. A male cone produces thousands of pollen grains that produce male gametophytes. Female cones produce female gametophytes. Male and female cones grow on separate cycads. Their natural habitats are tropics or subtropics.
Gingkophyta- This division has only one living species Gingko biloba. The gingko disappeared from North America during Ice Age but they survived in China where it was grown for seeds. They have male and female cones on separate plants. Male tree produces pollen grains in strobilus like cones growing from the base of leaf clusters. Female tree produces female cones which when fertilized give foul smell. Since gingkoes can tolerate smog and pollution, mae trees are grown in cities.
Gnetophyta- Plants in this division can live for 1500 to 2000 years. Ephedra, Gnetum and Welwitscia are common species of this division. They are found in deserts of Southwest Africa, United States and in tropical forests.
Conierophyta- Pines, firs, cypresses and redwoods belong to this division. These are very important economically. Reproductive structures develop in cones. Male and female cones are found in different branches of same tree. Small male cones produce pollen and large female cones remain on trees till the seeds are matured. Conifers are well adapted to survive in snowy climates.
Anthophyta- These are flowering plants that are widely distributed in terrestrial and aquatic environments. Also called
Chapter 21 Solutions
Biology Science Notebook
Additional Science Textbook Solutions
Microbiology: An Introduction
Concepts of Genetics (12th Edition)
Anatomy & Physiology (6th Edition)
Human Physiology: An Integrated Approach (8th Edition)
Chemistry: The Central Science (14th Edition)
Microbiology: An Introduction
- Awnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forward
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





