
Concept explainers
To label: The partial pressure of oxygen and carbon dioxide in the given figure of external respiration in the pulmonary circuit and internal respiration in the systemic circuit.
Introduction: Respiration is the process of gaseous exchange between the atmosphere and lungs. Respiration involves inhalation and exhalation activity, which is termed as breathing. Respiration is of two types, internal respiration and external respiration.

Answer to Problem 1CRQ
Pictorial representation: The partial pressure of oxygen and carbon dioxide of external respiration in the pulmonary circuit and internal respiration in the systemic circuit is labeled in Figure 1 given below:
Fig. 1: Partial pressure of oxygen and carbon dioxide
Explanation of Solution
The body tissues must be constantly supplied with oxygen and carbon dioxide must be constantly removed from the cells. To fulfill this purpose, the respiratory and circulatory systems function together. The pulmonary circuit assists the external respiration while the systemic circuit assists the internal respiration. The external respiration is the exchange of gases between the alveoli of lungs and the environment, whereas internal respiration is the exchange of gases between the blood and cells. The Po2 is higher in the surrounding environment than in the blood capillaries, hence oxygen diffuses into the blood capillaries. The Pco2 is lower in the surrounding environment than in the blood capillaries, hence carbon dioxide diffuses out of the blood capillaries. The partial pressure of oxygen and carbon dioxide of external respiration in the pulmonary circuit and internal respiration in the systemic circuit is labeled in the given figure.
Want to see more full solutions like this?
Chapter 21 Solutions
Student Worksheets For Visual Anatomy & Physiology
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





