
Foundations in Microbiology
9th Edition
ISBN: 9780073522609
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 20.5, Problem 19ELO
Summary Introduction
To determine:
The diseases attributable to infection with species in the genus Haemophilus, and identify which is most severe.
Introduction:
Haemophilus is genus of encapsulated rods, that uses components released by lysed RBCs for their energy
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 20 Solutions
Foundations in Microbiology
Ch. 20.1 - Explain the effect of the virulence factor common...Ch. 20.1 - Identify those people most at risk of developing a...Ch. 20.1 - Briefly describe the human infections caused by...Ch. 20.1 - How can antibiotic treatment of a gram-negative...Ch. 20.2 - Name the genera of bacteria that are...Ch. 20.2 - Outline the pathology and epidemiology of...Ch. 20.2 - Explain the epidemiology of Francisella tularensis...Ch. 20.2 - Prob. 6ELOCh. 20.2 - Prob. 7ELOCh. 20.2 - Prob. 8ELO
Ch. 20.2 - List the four genera of bacteria that cause...Ch. 20.2 - Prob. 4CYPCh. 20.2 - Prob. 5CYPCh. 20.2 - Prob. 6CYPCh. 20.2 - What is unusual about the reservoir of Legionella?...Ch. 20.3 - Recall the medically important members of the...Ch. 20.3 - Prob. 10ELOCh. 20.3 - Explain the importance of the three major surface...Ch. 20.3 - Name the key characteristics shared by the...Ch. 20.3 - Explain what is meant by IMViC.Ch. 20.3 - Prob. 10CYPCh. 20.3 - Prob. 11CYPCh. 20.3 - Briefly describe the methods used to isolate and...Ch. 20.3 - Prob. 13CYPCh. 20.4 - Differentiate among the major enteric pathologies...Ch. 20.4 - Explain the role of E. coli in infantile and...Ch. 20.4 - Prob. 14ELOCh. 20.4 - Prob. 14CYPCh. 20.4 - Prob. 15CYPCh. 20.4 - Justify treating E. coli Ol57:H7 differently from...Ch. 20.4 - Prob. 17CYPCh. 20.5 - Differentiate between true noncoliform enteric...Ch. 20.5 - Distinguish the pathologies of typhoidal and...Ch. 20.5 - Identify the possible sources of Shigella...Ch. 20.5 - Prob. 18ELOCh. 20.5 - Prob. 19ELOCh. 20.5 - Prob. 18CYPCh. 20.5 - Prob. 19CYPCh. 20.5 - What are the Five F’s and how do they relate to...Ch. 20.5 - Prob. 22CYPCh. 20.5 - Which body systems are commonly infected by...Ch. 20.5 - Describe the epidemiology and pathology of...Ch. 20.L1 - A unique characteristic of many isolates of...Ch. 20.L1 - Prob. 2MCQCh. 20.L1 - Prob. 3MCQCh. 20.L1 - A classic symptom of pertussis is a. labored...Ch. 20.L1 - Prob. 5MCQCh. 20.L1 - Prob. 6MCQCh. 20.L1 - Prob. 7MCQCh. 20.L1 - Which of the following is a major difference...Ch. 20.L1 - A complication/complications of typhoid fever...Ch. 20.L1 - Prob. 10MCQCh. 20.L1 - Prob. 11MCQCh. 20.L1 - Haemophilus influnzae is ____________ and requires...Ch. 20.L1 - Prob. 13MCQCh. 20.L1 - Prob. 14MCQCh. 20.L1 - Single Matching. Match the infectious agent with...Ch. 20.L1 - Prob. 1CSRCh. 20.L1 - Prob. 2CSRCh. 20.L1 - Prob. 3CSRCh. 20.L1 - Prob. 1WCCh. 20.L1 - What are unique features in the epidemiology of E....Ch. 20.L1 - Explain several practices an individual can use to...Ch. 20.L1 - Prob. 4WCCh. 20.L1 - Briefly outline the zoonotic infections in this...Ch. 20.L2 - What is the logic behind testing for E. coli to...Ch. 20.L2 - Identify the genera with the following...Ch. 20.L2 - Given that so many infections arc caused by...Ch. 20.L2 - Prob. 4CTCh. 20.L2 - Students in our classes sometimes ask how it is...Ch. 20.L2 - Explain lhe reasons for an increase in numbers of...Ch. 20.L2 - Compare and contrast the pathology, diagnosis, and...Ch. 20.L2 - Prob. 8CTCh. 20.L2 - Prob. 9CTCh. 20.L2 - Prob. 10CTCh. 20.L2 - "There is no circumstance [in which] you can cook...Ch. 20.L2 - Use figure 20.5 a, b as a reference guideline for...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Case Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Bacterial Infections in Humans; Author: Professor Dave Explains;https://www.youtube.com/watch?v=FeFKAl9KyMg;License: Standard Youtube License