CAMPBELL BIOLOGY (18W)
12th Edition
ISBN: 9780136858256
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 20.1, Problem 4CC
VISUAL SKILLS Ø Compare Figure 20.7 with Figure 16.20. How does replication of DNA ends during PCR proceed without shortening the fragments each time?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
VISUAL SKILLS If the DNA pol I in a given cell werenonfunctional, how would that affect the synthesis ofa leading strand? In the overview box in Figure 16.17,point out where DNA pol I would normally function onthe top leading strand.
Transcribe and translate the DNA strand Remember to use the start and stop sequences.
ACGGTACCGTTAGCCGACATCGGGGACACTGACTCG
Learning Task 2: Make a model of a DNA template to determine the sequence of bases in th new DNA strands.
Then, answer the guide questions that follow.
Materials: crayons. Scissors, paste/tape, used folder or illustration board
Procedure:
Use the pattern of the DNA template: (attached to this LP). Color code, phosphate - blue, deoxyribose
sugar = green, nitrogenous base as follows: adenine= yellow, thymine pink, guanine = violet, cytosine
= red. And cut the shapes of each nucleotides.
Build a model of a strand of a DNA molecule. The strand should contain 6 base" rungs" following the given
order of the nucleotides: Guanine, Adenine, Cytosine, Thymine, Cytosine, Guanine.
%3D
%3D
Tape the cutout pattern to form the nucieotides. This will represent the left half of DNA.
Make a complementary strand that you made in step 3. Tape the cut -out pattern again forming the
nucieotides for the second strand of the DNA molecules.
Match the bases of the first strand and the second strand. Do not tape…
Chapter 20 Solutions
CAMPBELL BIOLOGY (18W)
Ch. 20.1 - Prob. 1CCCh. 20.1 - DRAW IT One Strand of a DNA molecule has the...Ch. 20.1 - What are some potential difficulties in using...Ch. 20.1 - VISUAL SKILLS Compare Figure 20.7 with Figure...Ch. 20.2 - Prob. 1CCCh. 20.2 - Prob. 2CCCh. 20.3 - Based on current knowledge, how would you explain...Ch. 20.3 - Prob. 2CCCh. 20.3 - Prob. 3CCCh. 20.4 - What is the advantage of using stem cells for gene...
Ch. 20.4 - Prob. 2CCCh. 20.4 - Prob. 3CCCh. 20 - Describe how the process of gene doning results in...Ch. 20 - What useful Information is obtained by detecting...Ch. 20 - Describe how, using mice. a researcher could carry...Ch. 20 - What factors affecf whether a given genetic...Ch. 20 - In DNA technology, the term vector can refer to...Ch. 20 - Which of the following tools of DNA technology is...Ch. 20 - Prob. 3TYUCh. 20 - A paleontologist has recovered a bit of tissue...Ch. 20 - Which of the following is not true of cDNA...Ch. 20 - Expression of a cloned eukaryotic gene in a...Ch. 20 - Which Ii of the following sequences in...Ch. 20 - Prob. 8TYUCh. 20 - MAKE CONNECTIONS Looking at Figure 20.15, what...Ch. 20 - DRAW IT You are cloning an aardvark gene, using a...Ch. 20 - EVOLUTlON CONNECTION Ethical considerations aside,...Ch. 20 - Prob. 12TYUCh. 20 - Prob. 13TYUCh. 20 - Prob. 14TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Ⓒ Macmillan Learning The table shows where different restriction endonucleases (restriction enzymes) cleave DNA. The abbreviation R represents the purines (adenine and guanine). The pyrimidines (cytosine, thymine, and uracil) are abbreviated as Y. The abbreviation W represents adenine or thymine. Enzyme Target sequence 5' GAATTC 3' 3' CTTAAG 5' EcoRI ECORV HaeIII HindIII PpUMI 5' GATATC 3' 3' CTATAG 5' EcoRI HindIII EcoRV HaeIII 5' GGCC 3' 3' CCGG 5' Incorrect 5' AAGCTT 3' 3' TTCGAA 5' 5' RGGWCCY 3' 3' YCCWGGR 5' 5' TCAGAATTCGGTGA 3' Cleavage 5' G 3' CTTAA 5' GAT 3' CTA 5' GG 3' CC AATTC 3' G5' ATC 3' TAG 5' CC 3' GG 5' AGCTT 3' A 5' Which restriction endonucleases would cleave a DNA molecule at the given sequences? The complementary DNA substrate strand is omitted for clarity. 5' A 3' TTCGA 5' RG GWCCY 3' 3' YCCWG GR 5' 5' TCCAAGCTTGAATTC 3' EcoRV HaeIII HindIII EcoRI Incorrect Macmillan Learningarrow_forwardWhy should a student use the SQ3R method?arrow_forwardOrder the steps required to sequence a region of DNA using dideoxy sequencing. Amplify the region of DNA to be sequenced add a primer, deoxynucleotides, labeled dideoxynucleotides, and DNA polymerase a primer binds to the single-stranded DNA template DNA polymerase extends the primer, incorporating deoxynucleotides a labeled dideoxynucleotide terminates the growing DNA chain gel electrophoresis separates the mixture of DNA fragments by size The DNA sequence is determined denature the double-stranded DNA Answer Bankarrow_forward
- In Figure 10-14, why does DNA migrate to the anode(+ pole)?arrow_forwardCorrect order ib which the following enzynes would operate to fix a damaged nucleotide in a human gene. a) nuclease, DNA polymerase, RNA primase b) helicase, DNA polymerase, DNA ligase c) DNA ligase, nuclease, helicase d) nuclease, DNA polymerase, DNA ligasearrow_forwardExpand PCR? Describe the different Steps involved in this technique?arrow_forward
- What's the main difference between first-generation sequencing, second-generation sequencing and whole genome amplification.arrow_forwardDNA Restriction, Electrophoresis 1. What are restriction enzymes? 2. How do restriction enzymes function? 3. Why are restriction enzymes important in biochemistry labs? 4. What is DNA Gel Electrophoresis? 5. How does DNA Gel Electrophoresis function? 6. Why is DNA Gel Electrophoresis important in biochemistry labs?arrow_forwardExperiment: dna restriction digestionarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License