Why planting potatoes may be preferable to planting potato seeds, and which potatoes must be chosen for planting. Introduction: Potatoes can reproduce through both sexual and asexual means.

Question

Want to see more full solutions like this?

Answer 1

Question

Chapter 20, Problem 1SA

Summary Introduction

To analyze:

Why planting potatoes may be preferable to planting potato seeds, and which potatoes must be chosen for planting.

Introduction:

Potatoes can reproduce through both sexual and asexual means.

Expert Solution & Answer

Explanation of Solution

Potatoes can reproduce sexually, by flowering, pollination and seed production. These seeds can give rise to new plants. However, new potato plants can be obtained by planting potatoes from the parent plant. This is a form of asexual reproduction, and the new plant will be genetically identical to the parent. The farmer can therefore choose to plant potatoes that yield more and are tolerant to environmental stresses. Planting potatoes may be preferable, since the genetic composition of the plant is preserved in asexual reproduction. Potatoes which possess the characteristics that the farmer wants will be chosen for propagation.

Conclusion

Planting potatoes that are adaptable to their environment and tolerant to stresses may be preferable, since the genetic composition of the plant is preserved in asexual reproduction. The farmer will choose the potatoes with the characteristics that she/he wants to propagate in the next crop, such as high yielding or stress tolerant potatoes.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?

Answer 2

Question

Chapter 20, Problem 1SA

Summary Introduction

To analyze:

Why planting potatoes may be preferable to planting potato seeds, and which potatoes must be chosen for planting.

Introduction:

Potatoes can reproduce through both sexual and asexual means.

Expert Solution & Answer

Explanation of Solution

Potatoes can reproduce sexually, by flowering, pollination and seed production. These seeds can give rise to new plants. However, new potato plants can be obtained by planting potatoes from the parent plant. This is a form of asexual reproduction, and the new plant will be genetically identical to the parent. The farmer can therefore choose to plant potatoes that yield more and are tolerant to environmental stresses. Planting potatoes may be preferable, since the genetic composition of the plant is preserved in asexual reproduction. Potatoes which possess the characteristics that the farmer wants will be chosen for propagation.

Conclusion

Planting potatoes that are adaptable to their environment and tolerant to stresses may be preferable, since the genetic composition of the plant is preserved in asexual reproduction. The farmer will choose the potatoes with the characteristics that she/he wants to propagate in the next crop, such as high yielding or stress tolerant potatoes.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Question

Chapter 20, Problem 1SA

Summary Introduction

To analyze:

Why planting potatoes may be preferable to planting potato seeds, and which potatoes must be chosen for planting.

Introduction:

Potatoes can reproduce through both sexual and asexual means.

Expert Solution & Answer

Explanation of Solution

Potatoes can reproduce sexually, by flowering, pollination and seed production. These seeds can give rise to new plants. However, new potato plants can be obtained by planting potatoes from the parent plant. This is a form of asexual reproduction, and the new plant will be genetically identical to the parent. The farmer can therefore choose to plant potatoes that yield more and are tolerant to environmental stresses. Planting potatoes may be preferable, since the genetic composition of the plant is preserved in asexual reproduction. Potatoes which possess the characteristics that the farmer wants will be chosen for propagation.

Conclusion

Planting potatoes that are adaptable to their environment and tolerant to stresses may be preferable, since the genetic composition of the plant is preserved in asexual reproduction. The farmer will choose the potatoes with the characteristics that she/he wants to propagate in the next crop, such as high yielding or stress tolerant potatoes.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Question

Chapter 20, Problem 1SA

Summary Introduction

To analyze:

Why planting potatoes may be preferable to planting potato seeds, and which potatoes must be chosen for planting.

Introduction:

Potatoes can reproduce through both sexual and asexual means.

Expert Solution & Answer

Explanation of Solution

Potatoes can reproduce sexually, by flowering, pollination and seed production. These seeds can give rise to new plants. However, new potato plants can be obtained by planting potatoes from the parent plant. This is a form of asexual reproduction, and the new plant will be genetically identical to the parent. The farmer can therefore choose to plant potatoes that yield more and are tolerant to environmental stresses. Planting potatoes may be preferable, since the genetic composition of the plant is preserved in asexual reproduction. Potatoes which possess the characteristics that the farmer wants will be chosen for propagation.

Conclusion

Planting potatoes that are adaptable to their environment and tolerant to stresses may be preferable, since the genetic composition of the plant is preserved in asexual reproduction. The farmer will choose the potatoes with the characteristics that she/he wants to propagate in the next crop, such as high yielding or stress tolerant potatoes.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Chapter 20, Problem 1SA

Summary Introduction

To analyze:

Why planting potatoes may be preferable to planting potato seeds, and which potatoes must be chosen for planting.

Introduction:

Potatoes can reproduce through both sexual and asexual means.

Expert Solution & Answer

Explanation of Solution

Potatoes can reproduce sexually, by flowering, pollination and seed production. These seeds can give rise to new plants. However, new potato plants can be obtained by planting potatoes from the parent plant. This is a form of asexual reproduction, and the new plant will be genetically identical to the parent. The farmer can therefore choose to plant potatoes that yield more and are tolerant to environmental stresses. Planting potatoes may be preferable, since the genetic composition of the plant is preserved in asexual reproduction. Potatoes which possess the characteristics that the farmer wants will be chosen for propagation.

Conclusion

Planting potatoes that are adaptable to their environment and tolerant to stresses may be preferable, since the genetic composition of the plant is preserved in asexual reproduction. The farmer will choose the potatoes with the characteristics that she/he wants to propagate in the next crop, such as high yielding or stress tolerant potatoes.

Answer 6

Chapter 20, Problem 1SA

Summary Introduction

To analyze:

Why planting potatoes may be preferable to planting potato seeds, and which potatoes must be chosen for planting.

Introduction:

Potatoes can reproduce through both sexual and asexual means.

Expert Solution & Answer

Explanation of Solution

Potatoes can reproduce sexually, by flowering, pollination and seed production. These seeds can give rise to new plants. However, new potato plants can be obtained by planting potatoes from the parent plant. This is a form of asexual reproduction, and the new plant will be genetically identical to the parent. The farmer can therefore choose to plant potatoes that yield more and are tolerant to environmental stresses. Planting potatoes may be preferable, since the genetic composition of the plant is preserved in asexual reproduction. Potatoes which possess the characteristics that the farmer wants will be chosen for propagation.

Conclusion

Planting potatoes that are adaptable to their environment and tolerant to stresses may be preferable, since the genetic composition of the plant is preserved in asexual reproduction. The farmer will choose the potatoes with the characteristics that she/he wants to propagate in the next crop, such as high yielding or stress tolerant potatoes.

Answer 7

Chapter 20, Problem 1SA

Summary Introduction

To analyze:

Why planting potatoes may be preferable to planting potato seeds, and which potatoes must be chosen for planting.

Introduction:

Potatoes can reproduce through both sexual and asexual means.

Answer 8

Expert Solution & Answer

Explanation of Solution

Potatoes can reproduce sexually, by flowering, pollination and seed production. These seeds can give rise to new plants. However, new potato plants can be obtained by planting potatoes from the parent plant. This is a form of asexual reproduction, and the new plant will be genetically identical to the parent. The farmer can therefore choose to plant potatoes that yield more and are tolerant to environmental stresses. Planting potatoes may be preferable, since the genetic composition of the plant is preserved in asexual reproduction. Potatoes which possess the characteristics that the farmer wants will be chosen for propagation.

Answer 9

Expert Solution & Answer

Answer 10

Expert Solution & Answer

Answer 11

Conclusion

Planting potatoes that are adaptable to their environment and tolerant to stresses may be preferable, since the genetic composition of the plant is preserved in asexual reproduction. The farmer will choose the potatoes with the characteristics that she/he wants to propagate in the next crop, such as high yielding or stress tolerant potatoes.

Answer 12

Ch. 20 - Prob. 1SA Ch. 20 - Prob. 2SA Ch. 20 - Prob. 3SA Ch. 20 - Prob. 4SA Ch. 20 - Prob. 5SA Ch. 20 - Prob. 6SA Ch. 20 - Prob. 7SA Ch. 20 - Prob. 8SA Ch. 20 - Prob. 9SA Ch. 20 - Prob. 10SA

Why planting potatoes may be preferable to planting potato seeds, and which potatoes must be chosen for planting. Introduction: Potatoes can reproduce through both sexual and asexual means.

Solution Summary: The author analyzes why planting potatoes may be preferable to planting potato seeds, and which potatoes must be chosen for planting.

Concept explainers

Videos

To analyze:

Why planting potatoes may be preferable to planting potato seeds, and which potatoes must be chosen for planting.

Introduction:

Potatoes can reproduce through both sexual and asexual means.

Explanation of Solution

Want to see more full solutions like this?

Chapter 20 Solutions

Why planting potatoes may be preferable to planting potato seeds, and which potatoes must be chosen for planting. Introduction: Potatoes can reproduce through both sexual and asexual means.

Solution Summary: The author analyzes why planting potatoes may be preferable to planting potato seeds, and which potatoes must be chosen for planting.

Concept explainers

Videos

To analyze: Why planting potatoes may be preferable to planting potato seeds, and which potatoes must be chosen for planting. Introduction: Potatoes can reproduce through both sexual and asexual means.

Explanation of Solution

Want to see more full solutions like this?

Chapter 20 Solutions

To analyze:

Why planting potatoes may be preferable to planting potato seeds, and which potatoes must be chosen for planting.

Introduction:

Potatoes can reproduce through both sexual and asexual means.