Concept explainers
Introduction:
The molecular phylogeny is the main basis of the evolution of the fungal taxonomy. The classification systems are based on the evolutionary relationships between the groups and the classification is named as phylogenetic classification.

Answer to Problem 1MCQ
Correct answer:
The most similar type of organism with the ancestral
Explanation of Solution
Reason for the correct statement:
The ancestral fungus evolved into Chytridiomycetes first. Some of the Zygomycetes and Chytridiomycetes share a common ancestor. However, the Chytridiomycetes are closest to the ancestral fungus because of the similarities in the DNA (deoxyribonucleic acid) sequences.
Option (d) is given as “A chytrid”.
As, “the chytrids have the most similarities with the ancestral fungus because of the similarities in the DNA sequences”, is the right answer.
Hence, option (d) is correct.
Reasons for the incorrect statements:
Option (a), is given as “A bacterium”.
The bacteria are placed in the kingdom Monera and not fungi. Their evolution was different from fungus. Hence, it is a wrong answer.
Option (b), is given as “A plant”.
The plants belong to the kingdom Plantae and not fungi and the plants are more evolved than fungi. Hence, it is a wrong answer.
Option (c), is given as “A basidiomycete”.
The Basidiomycetes are considered as the most evolved fungi and hence they share very less similarities with the ancestral fungus. Hence, it is a wrong answer.
Hence, options (a), (b), and (c), are incorrect.
According to the DNA sequencing data, the Chytridiomycetes are considered as the most primitive types of fungi and the Basidiomycetes and Ascomycetes share a common ancestor and are more evolved than other phyla of fungi.
Want to see more full solutions like this?
Chapter 20 Solutions
BIOLOGY: CONCEPTS AND INVESTIGATIONS,
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax




