Anatomy & Physiology: An Integrative Approach
2nd Edition
ISBN: 9780078024283
Author: Michael McKinley Dr., Valerie O'Loughlin, Theresa Bidle
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 19.8, Problem 25WDYL
Pressure changes that occur during the cardiac cycle are responsible for what two physiologic processes within the heart?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 19 Solutions
Anatomy & Physiology: An Integrative Approach
Ch. 19.1 - What are the potential consequences of a failing...Ch. 19.1 - Prob. 2WDYLCh. 19.1 - What path does blood follow through the heart?...Ch. 19.1 - Which of the great vessels is both an artery and...Ch. 19.2 - Prob. 5WDYLCh. 19.2 - Describe the three layers that cover the heart....Ch. 19.3 - Prob. 7WDYLCh. 19.3 - What are the layers of the heart (in order) that a...Ch. 19.3 - What is the structure that separates the two...Ch. 19.3 - What are the functions of the tendinous cords and...
Ch. 19.3 - Which features of cardiac muscle support aerobic...Ch. 19.3 - Which function of the fibrous skeleton allows the...Ch. 19.4 - What areas of the heart are deprived of blood when...Ch. 19.4 - Prob. 14WDYLCh. 19.5 - Prob. 15WDYLCh. 19.5 - Which autonomic division is associated with the...Ch. 19.6 - Prob. 17WDYLCh. 19.6 - What is autorhythmicity? Describe how nodal cells...Ch. 19.6 - What is the path of an action potential through...Ch. 19.6 - What anatomic features slow the conduction rate of...Ch. 19.7 - In which direction does Ca2+ move in response to...Ch. 19.7 - What three electrical events occur at the...Ch. 19.7 - What is the significance of the extended...Ch. 19.7 - What events in the heart are indicated by each of...Ch. 19.8 - Pressure changes that occur during the cardiac...Ch. 19.8 - What is occurring during ventricular ejection?Ch. 19.8 - Prob. 27WDYLCh. 19.8 - Define end-diastolic volume, end-systolic volume,...Ch. 19.9 - What are the two factors that determine cardiac...Ch. 19.9 - What is the cardiac output at rest and during...Ch. 19.9 - Prob. 31WDYLCh. 19.9 - Describe the atrial reflex, which involves...Ch. 19.9 - Prob. 33WDYLCh. 19.9 - Prob. 34WDYLCh. 19.10 - What would be the path of blood flow through the...Ch. 19 - Which of the following is the correct circulatory...Ch. 19 - The pericardial cavity is located between the a....Ch. 19 - How is blood prevented from backflowing from the...Ch. 19 - ____ 4. Venous blood draining from the heart wall...Ch. 19 - _____ 5. Calcium channels in the nodal cells...Ch. 19 - ____6. Action potentials are spread rapidly...Ch. 19 - Why is it necessary to stimulate papillary muscles...Ch. 19 - ____ 8. Preload is a measure of a. stretch of...Ch. 19 - ____ 9. All of the following occur when the...Ch. 19 - ____10. What occurs during the atrial reflex? a....Ch. 19 - Prob. 11DYKBCh. 19 - Compare the structure, location, and function of...Ch. 19 - Prob. 13DYKBCh. 19 - Explain why the walls of the atria are thinner...Ch. 19 - Describe the structure and function of...Ch. 19 - Explain the general location and function of...Ch. 19 - Describe the functional differences in the effects...Ch. 19 - Prob. 18DYKBCh. 19 - List the five events of the cardiac cycle, and...Ch. 19 - Define cardiac output, and explain how it is...Ch. 19 - A young man was doing some vigorous exercise when...Ch. 19 - A young man was doing some vigorous exercise when...Ch. 19 - Prob. 3CALCh. 19 - Prob. 4CALCh. 19 - During surgery, the right vagus nerve was...Ch. 19 - Prob. 1CSLCh. 19 - Prob. 2CSLCh. 19 - Your grandfather was told that his SA node...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeBasic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage
Fundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage
Fundamentals of Sectional Anatomy: An Imaging App...
Biology
ISBN:9781133960867
Author:Denise L. Lazo
Publisher:Cengage Learning
The Cardiovascular System: An Overview; Author: Strong Medicine;https://www.youtube.com/watch?v=Wu18mpI_62s;License: Standard youtube license