An energy pyramid for an ecosystem with three levels of consumers. Introduction: The food chain is a linear order of feeding relationships among the species. Each organism has a different position in the food chain. Producers occupy the first place in the food chain because the food chain begins with primary producers.

Question

Want to see the full answer?

Answer 1

Question

Chapter 19.6, Problem 4MC

Summary Introduction

To sketch:

An energy pyramid for an ecosystem with three levels of consumers.

Introduction:

The food chain is a linear order of feeding relationships among the species. Each organism has a different position in the food chain. Producers occupy the first place in the food chain because the food chain begins with primary producers.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

What would happen if transcriptome analysis were done on liver and muscle cells?

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

Answer 2

Question

Chapter 19.6, Problem 4MC

Summary Introduction

To sketch:

An energy pyramid for an ecosystem with three levels of consumers.

Introduction:

The food chain is a linear order of feeding relationships among the species. Each organism has a different position in the food chain. Producers occupy the first place in the food chain because the food chain begins with primary producers.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 19.6, Problem 4MC

Summary Introduction

To sketch:

An energy pyramid for an ecosystem with three levels of consumers.

Introduction:

The food chain is a linear order of feeding relationships among the species. Each organism has a different position in the food chain. Producers occupy the first place in the food chain because the food chain begins with primary producers.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 19.6, Problem 4MC

Summary Introduction

To sketch:

An energy pyramid for an ecosystem with three levels of consumers.

Introduction:

The food chain is a linear order of feeding relationships among the species. Each organism has a different position in the food chain. Producers occupy the first place in the food chain because the food chain begins with primary producers.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 19.6, Problem 4MC

Summary Introduction

To sketch:

An energy pyramid for an ecosystem with three levels of consumers.

Introduction:

The food chain is a linear order of feeding relationships among the species. Each organism has a different position in the food chain. Producers occupy the first place in the food chain because the food chain begins with primary producers.

Answer 6

Chapter 19.6, Problem 4MC

Summary Introduction

To sketch:

An energy pyramid for an ecosystem with three levels of consumers.

Introduction:

The food chain is a linear order of feeding relationships among the species. Each organism has a different position in the food chain. Producers occupy the first place in the food chain because the food chain begins with primary producers.

Answer 7

Chapter 19.6, Problem 4MC

Summary Introduction

To sketch:

An energy pyramid for an ecosystem with three levels of consumers.

Introduction:

The food chain is a linear order of feeding relationships among the species. Each organism has a different position in the food chain. Producers occupy the first place in the food chain because the food chain begins with primary producers.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 19.1 - Distinguish between ecosystems, communities, and...Ch. 19.1 - Prob. 2MC Ch. 19.1 - What is the relationship between an organisms...Ch. 19.2 - Explain this statement: If Earths axis were not...Ch. 19.2 - Prob. 2MC Ch. 19.3 - Prob. 1MC Ch. 19.3 - Infer one adaptation of plants and one adaptation...Ch. 19.3 - Describe the types of organisms that live in each...Ch. 19.3 - Prob. 4MC Ch. 19.3 - Describe some of the adaptations that characterize...

Solution Summary: The author illustrates an energy pyramid for an ecosystem with three levels of consumers. The food chain is a linear order of feeding relationships among species.

Concept explainers

Videos

Want to see the full answer?

Chapter 19 Solutions