
Pearson eText Human Anatomy -- Instant Access (Pearson+)
9th Edition
ISBN: 9780135273005
Author: Elaine Marieb, Patricia Wilhelm
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Question
Chapter 19, Problem 6RQ
Summary Introduction
To determine:
The base of the heart.
Introduction:
The heart is located between the chest and the lungs above the diaphragm and behind the sternum. The heart has a pointed apex that is present left to the midsternal line. The heart has four chambers, two auricles and two ventricles. The chambers have atrioventricular and semilunar valves that prevent the backflow of blood.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 19 Solutions
Pearson eText Human Anatomy -- Instant Access (Pearson+)
Ch. 19 - Prob. 1CYUCh. 19 - Prob. 2CYUCh. 19 - What is another name for the epicardium?Ch. 19 - Identify the heart chamber or chambers that...Ch. 19 - Prob. 5CYUCh. 19 - Prob. 6CYUCh. 19 - During ventricular systole, are the AV valves open...Ch. 19 - Differentiate a stenotic valve from an incompetent...Ch. 19 - What is the significance of the gap junctions in...Ch. 19 - What is the pacemaker of the heart, and where is...
Ch. 19 - Prob. 11CYUCh. 19 - Prob. 12CYUCh. 19 - Prob. 13CYUCh. 19 - How would incomplete formation of the...Ch. 19 - Which chamber of the heart is formed from the...Ch. 19 - What is the single most important factor for...Ch. 19 - The most external part of the pericardium is the...Ch. 19 - Prob. 2RQCh. 19 - How many cusps does the right atrioventricular...Ch. 19 - Prob. 4RQCh. 19 - Prob. 5RQCh. 19 - Prob. 6RQCh. 19 - Prob. 7RQCh. 19 - Prob. 8RQCh. 19 - Prob. 9RQCh. 19 - Which layer of the heart wall is the thickest? (a)...Ch. 19 - The inferior left corner of the heart is located...Ch. 19 - Ben was annoyed when his lab partner insisted that...Ch. 19 - Describe the location of the heart within the...Ch. 19 - Trace a drop of blood through all the heart...Ch. 19 - Prob. 15RQCh. 19 - Sketch the heart and draw all the coronary vessels...Ch. 19 - Prob. 17RQCh. 19 - Prob. 18RQCh. 19 - Make a drawing of the adult heart and the...Ch. 19 - How do the right and left ventricles differ...Ch. 19 - Which is more resistant to fatigue, cardiac muscle...Ch. 19 - Describe the structure and function of an...Ch. 19 - Compare and contrast the structure of cardiac...Ch. 19 - Classify the three congenital heart...Ch. 19 - Prob. 2CRCAQCh. 19 - Prob. 3CRCAQCh. 19 - After a man was stabbed in the chest, his face...Ch. 19 - A heroin addict felt tired, weak, and feverish....Ch. 19 - Another patient had an abnormal heart sound that...Ch. 19 - Prob. 7CRCAQCh. 19 - During a lethal heart attack, a blood. clot lodges...Ch. 19 - Prob. 9CRCAQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Respiratory System; Author: Amoeba Sisters;https://www.youtube.com/watch?v=v_j-LD2YEqg;License: Standard youtube license