
EBK HUMAN ANATOMY & PHYSIOLOGY
16th Edition
ISBN: 8220100659836
Author: AMERMAN
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 19, Problem 6CYR
Summary Introduction
To review:
The blank space in the statement “Erythrocytes are derived from stem cells called _______, circulate in the blood for approximately ________ days, and are destroyed by an organ called the _______.”
Introduction:
Erythrocytes are formed elements of the blood, whose primary function is to carry oxygen to different parts of the body. It contains the protein hemoglobin that binds to the oxygen for delivery to various tissues. They donot have cellular machinery, hence have a small lifespan, and therefore, should be continuously replenished in the body.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 19 Solutions
EBK HUMAN ANATOMY & PHYSIOLOGY
Ch. 19.1 - Prob. 1QCCh. 19.1 - Prob. 2QCCh. 19.1 - 3. How does blood regulate temperature and...Ch. 19.1 - 4. What are the four main categories of plasma...Ch. 19.1 - Prob. 5QCCh. 19.2 - Describe the structure of a typical erythrocyte.Ch. 19.2 - Prob. 2QCCh. 19.2 - 3. Walk through the basic steps of...Ch. 19.2 - 4. What is the lifespan of an erythrocyte?
Ch. 19.2 - Prob. 5QC
Ch. 19.2 - Prob. 6QCCh. 19.2 - Prob. 7QCCh. 19.3 - How do granulocytes and agranulocytes differ?Ch. 19.3 - Prob. 2QCCh. 19.3 - Compare the two types of agranulocytes.Ch. 19.3 - 4. How do B and T lymphocytes differ?
Ch. 19.3 - 5. What does a monocyte become in the tissues?...Ch. 19.3 - Prob. 6QCCh. 19.3 - 7. How do the lymphoid and myeloid cell lines...Ch. 19.3 - 8. Where do T and B lymphocytes mature?
Ch. 19.4 - Prob. 1QCCh. 19.4 - Prob. 2QCCh. 19.5 - Prob. 1QCCh. 19.5 - Prob. 2QCCh. 19.5 - 3. How are platelets triggered to aggregate?
Ch. 19.5 - Prob. 4QCCh. 19.5 - How do the intrinsic/contact activation and...Ch. 19.5 - Prob. 6QCCh. 19.5 - Prob. 7QCCh. 19.5 - What is thrombolysis?Ch. 19.5 - Prob. 9QCCh. 19.5 - Prob. 10QCCh. 19.5 - Prob. 11QCCh. 19.5 - Prob. 12QCCh. 19.5 - Prob. 13QCCh. 19.5 - Prob. 14QCCh. 19.6 - Prob. 1QCCh. 19.6 - Prob. 2QCCh. 19.6 - Prob. 3QCCh. 19.6 - Prob. 4QCCh. 19.6 - Prob. 5QCCh. 19 - Prob. 1CYRCh. 19 - Prob. 2CYRCh. 19 - List the seven major functions of blood.Ch. 19 - Prob. 4CYRCh. 19 - Prob. 5CYRCh. 19 - Prob. 6CYRCh. 19 - Prob. 7CYRCh. 19 - Leukocytes are: a. nucleated cells that function...Ch. 19 - Prob. 9CYRCh. 19 - Fill in the blanks: Lymphocytes are derived from...Ch. 19 - Prob. 11CYRCh. 19 - Number the steps of hemostasis in order, putting 1...Ch. 19 - Prob. 13CYRCh. 19 - Prob. 14CYRCh. 19 - Prob. 15CYRCh. 19 - Prob. 16CYRCh. 19 - Prob. 17CYRCh. 19 - 18. Which antigens does a person with blood type...Ch. 19 - Prob. 19CYRCh. 19 - Prob. 20CYRCh. 19 - 1. Explain how blood, being a liquid, enables all...Ch. 19 - Prob. 2CYUCh. 19 - 3. The anticoagulant drug warfarin primarily...Ch. 19 - 4. Cirrhosis of the liver often reduces production...Ch. 19 - 1. A blood sample from your patient shows that she...Ch. 19 - Prob. 2AYKACh. 19 - Prob. 3AYKACh. 19 - Prob. 4AYKB
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning