Campbell Biology
12th Edition
ISBN: 9780135188743
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 18.3, Problem 2CC
WH AT IF? Ø Suppose the mRNA being degraded in Figure 18.14 coded for a protein that promotes cell division in a multicellular organism. What would happen if a muta- tion disabled the gene for the miRNA that triggers this degradation?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Pls Provide what is being asked in the picture given
What are the differences between miRNA and siRNA?
(Select all that apply.)
OmiRNAs carry the genetic information from the DNA in
the nucleus directly to the cytoplasm, and siRNAs are
involved in the degradation of specific mRNA molecules.
miRNAs are from 22 to 30 bases long, and siRNAs are 22
bases long.
O miRNAs carry the genetic information from the DNA in
the nucleus directly to the cytoplasm, and siRNAs help
with the processing of the initial mRNA transcribed from
DNA into a mature form.
miRNAs prevent translation of certain mRNAs, and
siRNAs are involved in the degradation of specific mRNA
molecules.
miRNAs are 20 to 22 bases long, and siRNAs are from 20
to 30 bases long.
. Eukaryotic processing of hnRNA into mature mRNA includes all of the following steps except:
ribosome attachment of methionine to the 5’-AUG-3’ codon
5’-addition of a 7-methylguanosine cap
3’-addition of a polyadenylated tail
splicing together of exons
excision of introns
Chapter 18 Solutions
Campbell Biology
Ch. 18.1 - How does binding of the trp corepressor to the trp...Ch. 18.1 - Describe the binding of RNA Polymerase,...Ch. 18.1 - WHAT IF? A certain mutation in E. coli changes...Ch. 18.2 - In general, what are the effects of histone...Ch. 18.2 - MAKE CONNECTIONS Speculate about whether the same...Ch. 18.2 - Compare the roles of general and specific...Ch. 18.2 - Once mRNA encoding a particular protein reaches...Ch. 18.2 - WHAT IF? Suppose you compared the nucleotide...Ch. 18.3 - Compare miRNAs and siRNAs, including their...Ch. 18.3 - WH AT IF? Suppose the mRNA being degraded in...
Ch. 18.3 - Prob. 3CCCh. 18.4 - MAKE CONNECTIONS As you learned in Chapter 12,...Ch. 18.4 - MAKE CONNECTIONS Explain how the signaling...Ch. 18.4 - How do fruit fly maternal effect genes determine...Ch. 18.4 - Prob. 4CCCh. 18.5 - Prob. 1CCCh. 18.5 - Under what circumstances is cancer considered to...Ch. 18.5 - MAKE CONNECTIONS The p53 protein can activate...Ch. 18 - Compare and contrast the roles of a corepressor...Ch. 18 - Describe what must happen in a cell for a gene...Ch. 18 - Why are miRNAs called noncoding RNAs? Explsin how...Ch. 18 - Describe the two main processes that cause...Ch. 18 - Compare the usual functions of proteins encoded by...Ch. 18 - If a particular operon encodes enzymes for making...Ch. 18 - Muscle cells differ from nerve cells mainly...Ch. 18 - The functioning of enhancers is an example of (A)...Ch. 18 - Cell differentiation always involves (A)...Ch. 18 - Which of the following is an example of...Ch. 18 - What would occur if the repressor of an inducible...Ch. 18 - Absence of bicoid in mRNA from a Drosophila egg...Ch. 18 - Which of the following statements about the DNA in...Ch. 18 - Within a cell, the amount of protein made using a...Ch. 18 - Prob. 10TYUCh. 18 - draw it The diagram below shows five genes,...Ch. 18 - Prob. 12TYUCh. 18 - SCIENCE. TECHNOLOGY, AND SOCIETY Trace amounts of...Ch. 18 - WRITE ABOUT A THEME: INTERACTIONS In a Short essay...Ch. 18 - SYNTHESIZE YOUR KNOWLEDGE The flashlight fish has...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Why do scientists think that all forms of life on earth have a common origin?
Genetics: From Genes to Genomes
True or false? Some trails are considered vestigial because they existed long ago.
Biological Science (6th Edition)
4.1 Write the symbols for the following elements.
a. copper
b. platinum
c. calcium
d. manganese
e. Iron
...
Chemistry: An Introduction to General, Organic, and Biological Chemistry (13th Edition)
Identify me theme or themes exemplified by (a) the sharp quills of a porcupine (b) the development of a multice...
Campbell Biology in Focus (2nd Edition)
Gregor Mendel never saw a gene, yet he concluded that some inherited factors were responsible for the patterns ...
Campbell Essential Biology (7th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Transcription factors function in the nucleus. However, like (almost) all eukaryotic proteins,they are translated in the cytosol. Can you draw a visual to explain how transcription factor proteinsenter the nucleus from the cytoplasm? Can you also include a representation of relevant proteins and proteindomains to explain how these proteins reach their destination. Thank youarrow_forwardWould the coupling of the processes shown in Figure 17.24 be found in a eukaryotic cell? Explain why or why not.arrow_forwardwill give ratingarrow_forward
- What are the functional consequences of this deletion for lilP mRNA transcription and translation? Motivate your answer (100 words max.)arrow_forwardmRNA: 5’ – UGAUCAUGAUCUCGUAAGAUAUC – 3’ -Draw a box around the sequence where protein synthesis will begin. What is this sequence called? Does an amino acid get inserted at this site? If so, which one? -Draw in an arrow to show the direction that a ribosome will move along the mRNA strand. -From the starting point, mark off the codons, and identify the correct amino acid that will be inserted at that codon. -Draw a second box around the sequence where protein synthesis will stop. What is this sequence called? -Label the N-terminus and C-terminus of the polypeptide (amino acid) chain.arrow_forwardSARS E You have generated several random mutations in this region. One of them is - 5'-AAUUACCUAUAGAUUGUUU-3' What may be the mutant protein sequence Enter the single letter code for the amino acids. For a stop codon (if any) enter: STOP And fill subsequent blanks with: N/A For example: if you the sequence you need to enter is: M*, enter M N/A N/A N/A N/Aarrow_forward
- List and briefly explain. C-terminal domain of RNA polymerase II function to ensure that the varoius sets of mRNA processing enzymes carry out their duties at the apporpiate time and place?arrow_forwardExplain how the miR-200 family of miRNAs behave as tumorsuppressorgenes. What happens when their expression is blocked or decreased?arrow_forwardGive typed full explanationarrow_forward
- SA p PDF as trasc d PDF During the translation of an mRNA segment, different activated tRNAs (aatRNAs)-specified here by their anticodons written 3' to 5' bind through hydrogen bonds to mRNA in subscripts-successively codons in the following order: Teas fill PDF Cave UNOFFIC aatRNAGAA binds, then aatRNACAC, then aatRNAUUG, then aatRNAGUU, then aatRNAGUG, then aatRNAGAC What would the sequence of that mRNA segment be? O GAA CAC UUG GUU GUG GAC O CUU GUG AAC CAA CAC CUG O CTT GTG AAC CAA CAC CTG O Glu-His-Leu-Val-Val-Asp hu O Search PD maste omissarrow_forwardCan you explain it?arrow_forwardThe diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY